We narrowed to 1,496 results for: asl;
-
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX302 OASL-V5 puro
Plasmid#158643PurposeLentiviral expression vector for constitutive expression of V5-tagged OASL.DepositorAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-AsLOV2x3-NLSx3
Plasmid#231566PurposeExpresses components of the LOOMINA optogenetic transcriptional control system.DepositorInsertdCas9-AsLOV2x3
UseCRISPRExpressionMammalianAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3xHA-mASL
Plasmid#34577PurposeNOTE: This plasmid contains 1xHA-mASL, not 3xHA-mASL.DepositorAvailable SinceDec. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET28b-HRASLS3-1-132
Plasmid#100725PurposeExpression of N-terminal region of human HRASLS3 in E.coliDepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL-NEMO
Plasmid#221267PurposeExpression of TASL-NEMO IKK binding site in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(FL)
Plasmid#221263PurposeExpression of TASL in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL-PLPLR
Plasmid#221266PurposeExpression of TASL-STING PLPLR in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV_dCas9-AsLOV2x3-NLSx3
Plasmid#231567PurposeExpresses components of the LOOMINA optogenetic transcriptional control system.DepositorInsertdCas9-AsLOV2x3
UseCRISPRExpressionMammalianAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only