We narrowed to 23,593 results for: promoter
-
Plasmid#49492Purposeexpresses human Gsk3beta with S9A (constitutively active) mutationDepositorInsertGSK3beta S9A (GSK3B Human)
ExpressionMammalianMutationS9A (constitutively active)PromoterCMVAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
FHRE-Luc
Plasmid#1789PurposeReporter plasmid for FOXO3a. Forkhead responsive element with luciferase readout.DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
Flag-ZDHHC11
Plasmid#231659PurposeExpresses human ZDHHC11 proteinDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/Myc-DNMT1
Plasmid#36939PurposeMammalian expression of human DNMT1 with myc tagDepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-FerH-ffLuc2-eGFP
Plasmid#71393PurposeLentiviral vector of luciferase-eGFP fusion gene driven by FerH promoterDepositorInsertFerH-ffLuc2-eGFP
UseLentiviralExpressionMammalianPromoterFerHAvailable SinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_mScarlet_CLASP_RGS2membrane
Plasmid#133086PurposePlasmid contains mScarlet with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-mScarlet-yeLANS). CLASP modulates nuclear localization of mScarlet in response to blDepositorInsertmScarlet-CLASP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(2xD-E)DsRed
Plasmid#200111PurposeFluorescent reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertmodified EGR1 promoter
ExpressionMammalianMutationhighly modified sequencePromoter2 copies of D-E element, no other promoter elemen…Available SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pCMV-AcGFP
Plasmid#131008PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a CMV promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpCMV and pTRE3G-BiAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-DDB1
Plasmid#19918DepositorInsertDDB1 (Damage-specific DNA binding protein 1) (DDB1 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLEX301-TagRFP
Plasmid#162035PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsRFPAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA/EF1a-mCherry
Plasmid#114199PurposeLentivirus compatible SpCas9/dCas9 sgRNA scaffold driven by the U6 promoter and mCherry driven by the EF1a promoterDepositorInsertsgRNA scaffold
UseLentiviralTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ERT2-iCre-ERT2
Plasmid#178059PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under Syn promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman synapsin 1 (Syn) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3 GCN1-3xFlag_IRES-iRFP
Plasmid#198388PurposeGCN1 expressionDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shRNA beta-catenin
Plasmid#18803Purpose3rd gen lentiviral vector for knocking down beta-catenin gene expressionDepositorAvailable SinceJuly 22, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCMV-IRES-Renilla Luciferase-IRES-Gateway-Firefly Luciferase (pIRIGF)
Plasmid#101139PurposeLuciferase reporter plasmid. Note that both renilla luciferase and ORF-firefly luciferase are encoded by a single mRNA and both are translated independently via internal ribosomal binding sites.DepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
Tagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α wt-pBabe-Puro
Plasmid#26055DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationwt cDNAAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pM-ABE
Plasmid#196292Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding ABE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding ABE in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-ATG9A
Plasmid#198529PurposeExpression of ATG9A-GFP fusion protein in mammalian cellsDepositorInsertATG9A (ATG9A Human)
TagsEGFPExpressionMammalianMutationsilent mutations in codons 4 and 775PromoterCMVAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only