We narrowed to 2,364 results for: NIG
-
Plasmid#124251PurposeIn vitro transcription plasmid for T7 transcription of Her2 ITD sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing Her2 sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templateTagsExpressionMutationPromoterT7Available sinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV128
Plasmid#124252PurposeIn vitro transcription plasmid for T7 transcription of KRAS WT sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing KRAS sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templateTagsExpressionMutationPromoterT7Available sinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV129
Plasmid#124253PurposeIn vitro transcription plasmid for T7 transcription of KRAS G12V sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing KRAS sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templateTagsExpressionMutationPromoterT7Available sinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pWAP-HGF
Plasmid#83503PurposeGeneration of transgenic mice overexpressing the HGF under the control of the WAP gene promoterDepositorInsertHGF (Hgf Mouse)
UseMouse TargetingTagsExpressionMutationalso contains beta-globin sequences from pUC198Promotermouse WAP (whey acidic protein)Available sinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
rd
Plasmid#112912PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tagDepositorInsertdematin (DMTN Human)
UseTagsGlutatione-S-Tranferase and precision protease si…ExpressionBacterialMutationPEST sequence near the N-terminal removed. 5′-GCG…PromoterT7Available sinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a-MICB*005-IRES-ZsGreen
Plasmid#114008PurposeInduces expression of human MICB allele 005 cDNADepositorInsertMICB*005 (MICB Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1a MICA*009-IRES-ZsGreen
Plasmid#114007PurposeInduces expression of human MICA allele 009 cDNADepositorInsertMICA*009 (MICA Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
rd-his
Plasmid#112911PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tag and non-cleavable C-terminal 6-his tagDepositorInsertdematin (DMTN Human)
UseTags6-his tag, Glutathione-S-Transferase, and preciss…ExpressionBacterialMutation89KSTSPPPSPEVWAD102 was replaced with 89KAAAGGGAG…PromoterT7Available sinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only