We narrowed to 2,484 results for: NIG
-
Plasmid#184379PurposeThe Tet3G gene is expressed under a constitutive EF1-alpha promoter. This protein binds a TRE3G promoter to activate gene transcription only in the presence of tetracycline or its analogs (e.g. doxycycline)DepositorInsertTet3G
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXs-SOX10
Plasmid#134669PurposeRetroviral expression of human SOX10DepositorInsertSRY-box transcription factor 10 (SOX10 Human)
UseRetroviralAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJV126
Plasmid#124250PurposeIn vitro transcription plasmid for T7 transcription of wildtype Her2 sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing Her2 sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV127
Plasmid#124251PurposeIn vitro transcription plasmid for T7 transcription of Her2 ITD sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing Her2 sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV128
Plasmid#124252PurposeIn vitro transcription plasmid for T7 transcription of KRAS WT sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing KRAS sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV129
Plasmid#124253PurposeIn vitro transcription plasmid for T7 transcription of KRAS G12V sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing KRAS sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs-OLIG2
Plasmid#134668PurposeRetroviral expression of human OLIG2DepositorInsertOLIG2 (OLIG2 Human)
UseRetroviralAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWAP-HGF
Plasmid#83503PurposeGeneration of transgenic mice overexpressing the HGF under the control of the WAP gene promoterDepositorInsertHGF (Hgf Mouse)
UseMouse TargetingMutationalso contains beta-globin sequences from pUC198Promotermouse WAP (whey acidic protein)Available SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only