We narrowed to 612 results for: lenticrispr
-
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP PHD-HAT
Plasmid#179548Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP PHD-HAT domain (aa 1279-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW214-lenti-sasgRNA-Esp3I-2kb-filler-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170812PurposeLentiviral vector to co-express an sasgRNA with NLS-mScarlet-IDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Myosin7B-sgRNA
Plasmid#154861PurposeLentiviral expression of Cas9 and sgRNA targeting Myosin7BDepositorAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable sinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
MsMUT_sgRNA1
Plasmid#111296PurposeCRISPR KO murine MUTDepositorInsertsgRNA1 against murine MUT
UseCRISPR and LentiviralExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
MsMUT_sgRNA3
Plasmid#111297PurposeCRISPR KO murine MUTDepositorInsertsgRNA3 against murine MUT
UseCRISPR and LentiviralExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'GAC)
Plasmid#170127PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'GAC)
Plasmid#170129PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only