We narrowed to 9,773 results for: ren
-
Plasmid#141579PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF0308
Plasmid#141574PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0304
Plasmid#141572PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0301
Plasmid#141569PurposeLentiviral vector for overexpressing the CREM transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYZ221
Plasmid#132952PurposecrRNA entry vector of Prrk1-Not1-HHR with FnCas12a in Schizosaccharomyces pombeDepositorInsertFnCas12a
UseCRISPR and Synthetic BiologyPromoteradh1Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_cpaA
Plasmid#133344Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets cpaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_cpaA
UseCRISPRPromoterconstitutiveAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB2
Plasmid#168801PurposeFluorogen activating protein (FAP) DiB2DepositorInsertFluorogen activating protein DiB2
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Hu_Plk5(WT)
Plasmid#136329PurposeHuman Plk5 WT in Gateway pENTRDepositorInsertPLK5 (PLK5 Human)
UseGateway CloningAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
SAH0141-0.0-conP01
Plasmid#79828PurposeTranscriptional interference assessment; strong interfering promoter, landing site for spacersDepositorInsertsBlue fluorescent protein
mCherry
Promoterbla P3 and conP01Available SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
SAH0146-0.5-conP01
Plasmid#79831PurposeTranscriptional interference assessment; strong interfering promoter, 500 bp spacerDepositorInsertsBlue fluorescent protein
mCherry
Promoterbla P3 and conP01Available SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
SAH0098-scrPX
Plasmid#79830PurposeTranscriptional interference assessment; no interfering promoter (scrambled)DepositorInsertsBlue fluorescent protein
mCherry
Promoterbla P3 and scrPX (no promoter activity)Available SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB134
Plasmid#68588PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsGlucocorticoid receptor (GR)ExpressionPlantPromoterMpHSP17.8A1 promoterAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB334
Plasmid#68662PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsGlucocorticoid receptor (GR)ExpressionPlantPromoterMpHSP17.8A1 promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
4QOX
Plasmid#61959PurposeBaculovirus expression for structure determination; may not be full ORFDepositorInsertPP-CDPK4
UseBaculovirus expressionTagsMHHHHHHSSGRENLYFQGMutationSee commentsPromoterPolyhedrinAvailable SinceMay 27, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIhh715bp-Luc
Plasmid#53606PurposeReporter construct containing a 715 bp promoter region of the Ihh gene in front of a luciferase gene for in vitro DNA transfection assaysDepositorInsertIhh promoter
UseLuciferase; ReporterAvailable SinceJune 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_G13-L
Plasmid#25762PurposeEntry vector with TRE promoter driving mouse G alpha 13 miR30-based shRNA.DepositorInsertG alpha 13 miR-shRNA
UseGateway CloningAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_MTF2_HTC3xF_Puro_donor
Plasmid#246392PurposeMTF2 donor plasmid with puromycin resistanceDepositorAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_PHF1_KO_BSD_donor
Plasmid#246396PurposePHF1 KO donor plasmid with blasticidin resistanceDepositorAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only