We narrowed to 3,878 results for: ATR
-
Plasmid#38880PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only
-
U6-sgRNA-BbsI-CMV-EGFP cloning vector
Plasmid#239464PurposesgRNA cloning vector with EGFP expression cassette. An sgRNA spacer sequence can be cloned into BbsI sites. A CMV-EGFP expression cassette is included as a reporter of transfection efficiency.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP1P2-PTPN22
Plasmid#195391PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P1 and P2 domains) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…Available SinceApril 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP2-PTPN22
Plasmid#195395PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P2 domain) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-deltaP1-PTPN22
Plasmid#195388PurposeMammalian expression of a human PTPN22 mutant (exon 1-17 without the P1 domain) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17 and lacking…Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
MS2592.EF1a.SLC6A1.S295L.RFP.P2A.PURO.JL.p163
Plasmid#170174PurposeLentiviral Expression of EF1a.SLC6A1.S295L.RFPDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2592.EF1a.SLC6A1.A288V.P2A.PURO.JL.p166
Plasmid#170171PurposeLentiviral Expression of EF1a.SLC6A1.A288VDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK587
Plasmid#71696PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with a C-terminal His6 tag and Cys138>Ser mutant (AaTrxB1H6-C138S)DepositorInsertthioredoxin reductase 1
TagsHis6ExpressionBacterialMutationchanges cysteine-138 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only