Skip to main content
Addgene
Showing: 1 - 20 of 106 results
  1. Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More

    Type
    Blog Post
    ...Nicola Patron is Head of Synthetic Biology at the Sainsbury Laboratory, where she often feels more like...that go on between plants and their pathogens. As Patron explains it, her work has always been focused on...Modular Cloning (MoClo) Kit. What does it include? Patron: Sainsbury has a mandate to share and educate and...Addgene: Will the MoClo tools work in any plant? Patron: The MoClo kit is entirely for dicots, not grasses...tips for those looking to get started with MoClo? Patron: The parts will be familiar to most plant scientists...there other tools you are working on for plants? Patron: Our lab and others at the Sainsbury are working... of engaging about science in that way for you? Patron: I started my Twitter account recently inspired...
  2. p53 Pathway

    Type
    Collection
    ...activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine kinase B99 G-2 and S-phase expressed...ribonucleotide reductase M2 B (RRM2B) PAG608 Zinc finger, matrin-type 3 PAI Serpin peptidase inhibitor, clade E ...
  3. Supporting Rare Disease Research with BeHeard 2017

    Type
    Blog Post
    ...prevalence of spinal muscular atrophy (SMA)." European Journal of Paediatric Neurology 19 (2015): S64-S65...afflictions. Elia Di Schiavi - Spinal muscular atrophy Dr. Elia Di Schiavi is a Research Scientist at ...Naples, Italy. His group works on spinal muscular atrophy, a disease in which disruption of the smn1 gene...the smn1 gene is known to cause spinal muscular atrophy, the molecular mechanisms behind the disease are...restore motor neuron function in spinal muscular atrophy patients. Noushin Nabavi - Peritoneal Mesothelioma...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Arrowsmith 32880 FLAG-MATR3 MATR3 Flag CMV ALS Yossi Shiloh 32881 FLAG-Matr3 delRRM1 MATR3 Flag CMV ALS Yossi...Shiloh 32882 FLAG-Matr3 delRRM2 MATR3 Flag CMV ALS Yossi Shiloh 32883 FLAG-Matr3 delZnF1 MATR3 Flag CMV ALS...H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch SOD1 H1 ALS Patrick Aebischer...ALS Yossi Shiloh 32884 FLAG-Matr3 delZnF2 MATR3 Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y...CMV Parkinson's Patrick Aebischer 36070 pAAV asyn S87A/S129A SNCA CMV Parkinson's Patrick Aebischer 36071...EGFP OPTN GFP CMV ALS Beatrice Yue 68839 pOPTN1-209-EGFP OPTN GFP CMV ALS Beatrice Yue 68840 pOPTN1-424...EGFP OPTN GFP CMV ALS Beatrice Yue 68841 pOPTN217-577-EGFP OPTN GFP CMV ALS Beatrice Yue 68842 pOPTN217-...
  5. Antibodies 101: The Basics of Western Blotting

    Type
    Blog Post
    ...anode/iblot gel matrix, the blotting membrane, the gel, a copper cathode/iblot gel matrix, and filter paper...remain intact and the protein is separated through a matrix by charge. In a denaturing western, the protein...smaller molecules moving more quickly through the matrix. For the purpose of this blog, we will be focusing...proteins encounter less resistance in the acrylamide matrix and migrate faster through the gel. For better ...
  6. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ... and were only available as green probes. The Patriarchi Lab aimed to overcome these limitations by developing...researchers looking to study norepinephrine, the Patriarchi lab continues to work on further improvements...nLightG. Many thanks to Mike Waring and Tommaso Patriarchi for their assistance with this blog post. References...Benke, D., Weber, B., Bohacek, J., Reiner, A., … Patriarchi, T. (2023). Sensitive multicolor indicators for...
  7. Common Injection Routes in Mice

    Type
    Blog Post
    ... do not require any punctures. Intratracheal instillation Intratracheal instillation is used to deliver...Intranasal instillation is very similar to its intratracheal counterpart, as both procedures target the lungs...Anesthesia Spinal cord 30 up to 0.01 mL Expert Intratracheal Anesthesia Trachea 20–23 (tubing) < 0.07 mL ...
  8. Important Considerations When Using AAVs

    Type
    Blog Post
    ...communities. Many thanks to our guest blogger Katrina Armstrong. Katrina Armstrong is a Neurophysiology Msc Student...This post was contributed by guest blogger Katrina Armstrong, a Neurophysiology Msc Student at the University...serotonin in movement. Follow her on twitter @katrinaboards.   References 1. Russell, David W. "AAV vectors...
  9. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ...Kamenyeva et al. 2015)? How do blood monocytes patrol blood vessels during immune responses (Auffray ...and tissues by a population of monocytes with patrolling behavior." Science 317.5838 (2007): 666-670. ...17673663. 14. Finsterbusch, Michaela, et al. "Patrolling monocytes promote intravascular neutrophil activation... PubMed PMCID: PMC5024581. 15. Celli, Susanna, Béatrice Breart, and Philippe Bousso. "Intravital two-photon...
  10. Addgene’s Top 10 Blog Posts from 2014

    Type
    Blog Post
    ...Resistance Genes By Marcy Patrick Plasmids 101: Yeast Vectors By Marcy Patrick CRISPR-Cas9 FAQs Answered...Morgan Plasmids 101: Mammalian Vectors By Marcy Patrick Will You Be My Mentor? Finding and Asking for...
  11. New Tools Enable CRISPRa for Neuroscience Applications

    Type
    Blog Post
    ...guest blogger Patrick Miller-Rhodes from the University of Rochester Medical Center. Patrick Miller-Rhodes...This post was contributed by Patrick Miller-Rhodes, a Ruth L. Kirschstein NRSA Predoctoral Fellow at ...
  12. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...) -  perhaps you’ll choose to study Crepidula atrasolea or Prochlorococcus with your next project. Gymnotiformes... aspects of cognition. Spiralians - Crepidula atrasolea (Jonathan Henry) This black footed slipper snail...bottleneck. New gif for #MolluscMonday: #Crepidula atrasolea juvenile, light microscope with polarizing filter...
  13. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ... that they can be imported to the mitochondrial matrix. Gottlieb’s lab has used an inducible MitoTimer...Addgene depositors Sylvestre Marillonnet and Nicola Patron have assembled two collections of standardized ...general eukaryotic multigene constructs, while the Patron Lab MoClo Plant Parts kit contains modules specific.../sb4001504. For further reading about Nicola Patron's MoClo kit and her plant synbio research, read ...
  14. Validated gRNA Sequences

    Type
    Collection
    ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...
  15. Immunology Research Plasmids and Resources

    Type
    Collection
    ...FMRFAL NPPA natriuretic peptide precursor A ANF, ANP, ATFB6, CDD-ANF, PND NPPB natriuretic peptide precursor...precursor B BNP NPPC natriuretic peptide precursor C CNP NPR1 natriuretic peptide receptor A/guanylate ...cyclase A (atrionatriuretic peptide receptor A) ANPRA, ANPa, GUC2A, GUCY2A, NPRA NPR3 natriuretic peptide...type 2 AT2, ATGR2, MRX88 AMBN ameloblastin (enamel matrix protein) - AMELX amelogenin (amelogenesis imperfecta...peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) ANPRC, GUCY2B, NPRC NPY neuropeptide...
  16. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...AAV9 Biosensors Patriarchi New viral service pAAV_hSyn1_nLightR AAV9 Biosensors Patriarchi New viral service...
  17. Six Spooky Science Stories and Halloween at Addgene

    Type
    Blog Post
    ...their jaws into a leaf, and dies as its muscles atrophy. After the ant’s death, the fungal fruiting bodies...blood out. Once the blood is depleted, the tongue atrophies and falls off. The louse remains becoming the ...
Showing: 1 - 20 of 106 results