We narrowed to 60,645 results for: promoter
-
Plasmid#51501PurposeSingle component LSL vector with GFP. Rep is expressed from the complementary sense LIR promoter. GFP is between LIR and SIR and is driven from a 2X35S promoter. Rep is within the repliconDepositorInsertGFP
UsePlant t-dna plasmidPromoter2x35SAvailable SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV flex SYN PSAM4 GlyRM3M4 HA
Plasmid#250133PurposeCre-dependent expression of inhibitory chemogenetic receptor PSAM4GlyR with HA tagDepositorAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGL4_NFAT-RE-CMVmin-BC0524-luc2
Plasmid#227139PurposeBarcoded assay, Ca2+ sensor; barcode BC0524DepositorInsert6x clustered NFAT element linked to CMV minimal promoter driving barcode 0524 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP6
Plasmid#218245Purpose1) Ectopic expression of MAAP6 protein in mammalian cells. 2) Packaging MAAP6 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 6 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP9
Plasmid#218246Purpose1) Ectopic expression of MAAP9 protein in mammalian cells. 2) Packaging MAAP9 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP2
Plasmid#218244Purpose1) Ectopic expression of MAAP2 protein in mammalian cells. 2) Packaging MAAP2 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 2 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+CMV-Ins-GLuc
Plasmid#89929PurposeExpresses Insulin-GLuc from the CMV promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.DepositorInserthuman insulin-Gaussia-Luciferase (INS Synthetic, Human)
ExpressionMammalianMutationDNA sequence for Gaussia luciferase was humanized…PromoterCMVAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-emerin-EGFP-polyA
Plasmid#59747PurposeExpress emerin-EGFP in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.DepositorInsertemerin-EGFP
TagsEGFPExpressionMammalianPromoterCMV and T7Available SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKAR1/Pur
Plasmid#23105PurposeAllows expression of shRNA from U6 promoter and a rescue cDNA from a doxycycline (Tet) inducible promoter in the same plasmid. Contains puromycin resistance geneDepositorTypeEmpty backboneUseRNAiTagsFlagExpressionMammalianPromoterTRE for cDNA; U6 for shRNAAvailable SinceMay 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPROBE-gfp[tagless]
Plasmid#40164DepositorInsertPromotor probe
Available SinceDec. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCHW110032
Plasmid#222438PurposeLevel 0, promoter module (GGAG-AATG) containing CBS4 and CMV1 promoters.DepositorInsertCBS4-CMV1, , CBS4 promoter + CMV1 (Cucumber mosaic virus)
UseSynthetic BiologyExpressionPlantMutationnoAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTmpKmA1O4out
Plasmid#176233PurposeA template plasmid for amplification of the cI-hok-neo cassette, which contains LacI-repressible A1O4 promoter. The promoter is directed outward the cI gene.DepositorInsertcI of phage lambda, hok of the R1 plasmid, neo, hybrid PA1O4 promoter
UseSynthetic BiologyExpressionBacterialAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
2.1 kB VEGF-luc
Plasmid#27988DepositorInsert2.1 kB VEGF
UseLuciferaseAvailable SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMU-PMr
Plasmid#61180PurposeFluorescent reporter for plasma membrane AtPIP2a-mCherry expressed under AtUBQ10 promoterDepositorInsertAtPIP2a
TagsmCherryExpressionPlantPromoterAtUBQ10Available SinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Susd4(3.7)-EGFP-sv40
Plasmid#184413PurposeAAV expression of tTA from mouse sushi domain containing 4 (Susd4) gene promoter.DepositorInsertMouse Susd4 gene promoter-EGFP (Susd4 Mouse)
UseAAVTagsEGFPExpressionMammalianPromoterMouse Susd4 geneAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP FL
Plasmid#179550Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human CBP driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human CBP (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4_CRE-CMVmin-BC0491-luc2
Plasmid#227133PurposeBarcoded assay, cAMP/Ca2+ sensor; barcode BC0491DepositorInsert6x clustered CRE element linked to CMV minimal promoter driving barcode 0491 and a luciferase reporter gene
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRU1144
Plasmid#14471DepositorInsertmRFP1
ExpressionBacterialAvailable SinceApril 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLenti.PGK.chFP.W
Plasmid#51008PurposeLentivector that expresses chFP from internal human PGK promoterDepositorInsertmChFP
UseLentiviralExpressionMammalianPromoterhuman PGKAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only