We narrowed to 61,299 results for: SAP
-
Plasmid#146109PurposeBacterial Expression of HsEDC3_192-508del231-263-HsRckDepositorInsertHsEDC3_192-508del231-263-HsRck (EDC3 Human)
ExpressionBacterialAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-BclXL-ActA-pEGFP-C1
Plasmid#177410PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-ActA: Bcl-XL with its membrane binding region swapped for ActA (mitochondrial targeting sequence).DepositorInsertBcl-XL-ActA, BclX-acta
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-ActA-s2193
Plasmid#177411PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-ActA: Bcl-XL with its membrane binding region swapped for ActA (mitochondrial targeting sequence).DepositorInsertBcl-XL-ActA, BclX-acta
TagsmCerulean3ExpressionMammalianPromoterHuman ferritinAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-Cb5-s2193
Plasmid#177413PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsmCerulean3ExpressionMammalianPromoterHuman ferritinAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-Cb5-pEGFP-C1
Plasmid#177414PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsmCerulean3ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-BclXL-Cb5-pEGFP-C1
Plasmid#177415PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bcl2-ActA-pEGFP-C1
Plasmid#177419PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-ActA: Bcl-2 with its membrane binding region swapped for ActA (mitochondrial targeting sequence).DepositorInsertBcl-2-ActA, Bcl2-acta, Bcl-acta
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bcl2-cb5-pEGFP-C1
Plasmid#177422PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
TagsVenusExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-B3GALT5
Plasmid#192719PurposeGateway entry vector encoding human B3GALT5DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R_pp
Plasmid#185061PurposeEf1a driven PE2 with pegRNA for editing C201R mutation (including silent PAM mutation) in KCNQ2. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-HsMex3C_1-225_AD
Plasmid#148497PurposeMammalian Expression of HsMex3C_1-225DepositorInsertHsMex3C_1-225 (MEX3C Human)
ExpressionMammalianMutationone non silent mutation compared to variant 2 fro…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-MS2-HA-C1-HsYTHDC2_1-1068_AD
Plasmid#148491PurposeMammalian Expression of HsYTHDC2_1-1068DepositorInsertHsYTHDC2_1-1068 (YTHDC2 Human)
ExpressionMammalianMutationone non silent mutation D233G and a deletion of 2…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-MS2-HA-C1-HsYTHDC2_1069-1430_AD
Plasmid#148492PurposeMammalian Expression of HsYTHDC2_1069-1430DepositorInsertHsYTHDC2_1069-1430 (YTHDC2 Human)
ExpressionMammalianMutationone non silent mutation L1409Q annotated as natur…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2151 pHAGE-hSPC-TFEB-TagBFP-W
Plasmid#188722PurposeLentiviral vector allowing for SFTPC-driven expression of TFEB:tagBFP fusion proteinDepositorAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2iC6FAST1nls2ER4(#638)
Plasmid#184068Purposecyclofen-inducible YFAST nuclear relocation via mammalian cell transfection or mRNA synthesisDepositorInsertYFAST-2nls-ERT2
UseSynthetic BiologyExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSTG4FER3(#190)
Plasmid#184069Purposecyclofen-inducible GAL4 activation via mammalian cell transfection or mRNA synthesisDepositorInsertGal4bdFF-ERT2
UseSynthetic BiologyExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1-1609_H
Plasmid#146440PurposeMammalian Expression of HsTNRC6A_1-1609DepositorInsertHsTNRC6A_1-1609 (TNRC6A Human)
ExpressionMammalianMutationA339T, R934G, D1289G, K1578E compared to the sequ…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-PPP2R5A-1
Plasmid#179352PurposeshRNA suppressionDepositorInsertB56α
UseLentiviralExpressionMammalianPromoterAge1Available SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only