We narrowed to 14,498 results for: SHR;
-
Plasmid#220903PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (BsaI site), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8932
Plasmid#220906PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PG-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideSLC35C1-neo
Plasmid#220868Purposeencodes CRISPR sgRNA targeting human SLC3C1DepositorInsertSLC35C1 (SLC35C1 Human)
UseLentiviralAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyA-GFP
Plasmid#220189PurposesgRNA expression vector - pEM7 promoter with GFP in sgRNA siteDepositorInsertpEM7 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpEM7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyD-GFP
Plasmid#220192PurposesgRNA expression vector - pBG28 promoter with GFP in sgRNA siteDepositorInsertpBG28 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG28Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK43
Plasmid#222223PurposeEdits NPAS2 Gene.DepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-bacteria_speG_M15
Plasmid#220488Purposeinducible CRISPRiDepositorInsertgspeG
UseCRISPR and RNAiMutationnoneAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-bacteria_speG_E23
Plasmid#220489Purposeinducible CRISPRiDepositorInsertgspeG
UseCRISPR and RNAiMutationnoneAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LV-sgRNA-mCherry-Puro sgPIDD
Plasmid#211528PurposeDeletes PIDDDepositorInsertsgPIDD
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520 sgRPS3
Plasmid#211526PurposeFacilitate knock-in of RPS3-Keima fusion proteinDepositorInsertsgRPS3
UseCRISPRExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 hygro sgUCK1
Plasmid#211524PurposeDeletes UCK1DepositorInsertsgUCK1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB4
Plasmid#197357PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-bleo-ErbB4
Plasmid#197353PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB1
Plasmid#197354PurposeA knock-out vector for dog ErbB1.DepositorInsertA gRNA targeting the dog EGFR gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only