We narrowed to 27,366 results for: c-myc
-
Plasmid#191594PurposeptpTALECD vector assembly, Entry clone 3 with attL2 and L3DepositorInsertC and N termini of platinum TALEN, 1/2 a cytidine deaminase domain of DddA of B. cenocepacia, and a uracil glycosylase inhibitor
UseOtherAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
E3_pENTR_L3-L2_NN_G1397-DddtoxA-C
Plasmid#191595PurposeptpTALECD vector assembly, Entry clone 3 with attL2 and L3DepositorInsertC and N termini of platinum TALEN, 1/2 a cytidine deaminase domain of DddA of B. cenocepacia, and a uracil glycosylase inhibitor
UseOtherAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
E1_pENTR_L1-L4_HD_G1333-DddtoxA-C
Plasmid#191579PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC and N termini of platinum TALEN, 1/2 a cytidine deaminase domain of DddA of B. cenocepacia, and a uracil glycosylase inhibitor
UseOtherAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
E1_pENTR_L1-L4_NG_G1333-DddtoxA-C
Plasmid#191580PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC and N termini of platinum TALEN, 1/2 a cytidine deaminase domain of DddA of B. cenocepacia, and a uracil glycosylase inhibitor
UseOtherAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
E1_pENTR_L1-L4_HD_G1333-DddtoxA-N
Plasmid#191581PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC and N termini of platinum TALEN, 1/2 a cytidine deaminase domain of DddA of B. cenocepacia, and a uracil glycosylase inhibitor
UseOtherAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
E1_pENTR_L1-L4_NG_G1333-DddtoxA-N
Plasmid#191582PurposeptpTALECD vector assembly, Entry clone 1 with attL1 and L4DepositorInsertC and N termini of platinum TALEN, 1/2 a cytidine deaminase domain of DddA of B. cenocepacia, and a uracil glycosylase inhibitor
UseOtherAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Donor_C_FH_Nbr
Plasmid#186662PurposeDonor plasmid to endogenously tag Nbr gene in Drosophila melanogaster at the C-terminal.DepositorInsertOSS Nbr C-terminal 3xFlag-3xHA Tag Donor Plasmid (Nbr Fly)
Tags3xFlag-3xHAExpressionInsectAvailable sinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB2HoptX
Plasmid#163832PurposeInactive two-hybrid system that confers spectinomycin resistance in response to substrate phosphorylation. Constitutive expression of c-src kinase, CDC37, and PTP1BDepositorInsertSpecR
UseSynthetic BiologyExpressionBacterialMutationMidT Substrate Y4FPromoterPro1;ProD;pLacZ-OptAvailable sinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-INTS3-C
Plasmid#128642PurposeExpress INTS3 C-termini (514-1042 aa) in E. coli with N-terminal and C-terminal His tagDepositorInsertINTS3 C-termini (INTS3 Human)
TagsHis tag on N and C-terminalExpressionBacterialMutationINTS3 C-termini (514–1042 aa)PromoterT7Available sinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
MAP3K8 gRNA (BRDN0001146430)
Plasmid#75921Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K8DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIRES-Neo-HA-cdc25C5
Plasmid#40967DepositorAvailable sinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-Venus-cdc25C5
Plasmid#40969DepositorAvailable sinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR221 UBR5 ∆PABC
Plasmid#81064PurposeGateway entry vector encoding full length UBR5 Y2402A/K2415A (∆PABC)DepositorInsertUbiquitin protein ligase E3 component N-recognin 5 (UBR5) ∆PABC (UBR5 Human)
UseCloningMutationY2402A and K2415A (bp t7204g, a7205c, t7206c, a72…PromoterN/AAvailable sinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-deltaBamHI-human MIZ1
Plasmid#74167PurposeMammalian expression of human MIZ1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMIZ1 (ZBTB17 Human)
ExpressionMammalianPromoterCMVAvailable sinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
6xHis-TEV-GEI-17(133-509)
Plasmid#87056PurposeExpresses 6xHis-tagged gei-17 (isoform f), with a TEV protease cleavage site between the tag and the ORFDepositorInsertGEI-17 isfoomr f (aa 133-509) (gei-17 Nematode)
Tags6xHis-TEV and GAGGGS linkerExpressionBacterialPromoterT7Available sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
BIRC3A
Plasmid#42378PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M5-U6-sgRNA-M7-U6-sgRNA-M9-IRES-CFP
Plasmid#114729Purpose3 sgRNAs targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA M5, sgRNA M7, sgRNA M9
UseCRISPRExpressionMammalianAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pQdCas12a.sggfp(C)
Plasmid#236042PurposeThe plasmid pQdCas12a.sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only