We narrowed to 6,894 results for: mcherry
-
Plasmid#191692PurposeFor knocking pCAG-EGFPnls into AAVS1 locusDepositorInsertAAVS1 homology arms and pCAG-EGFPnls
ExpressionMammalianMutationWTAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-mC-G-LC3B-P
Plasmid#124974Purposeevaluate autophagyDepositorInsertmCherry-GFP-LC3B
UseLentiviralPromoterCMVAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCherryGFP-Inframe-noFSE
Plasmid#177619PurposeDual fluorescent protein reporter for SARS-CoV-2 programmed -1 ribosomal frameshifting. No FSE was inserted. mCherry and GFP are expressed equally (positive control).DepositorInsertNone
UseLentiviralExpressionMammalianAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pCVL.SSA TLR (Sce)
Plasmid#45576PurposeCodes for the SSA-TLR with the target site for I-Sce I in a lentiviral backboneDepositorInserts5' iRFP arm
eGFP with I-Sce I TS
+3 mCherry
3' iRFP arm
UseLentiviralExpressionBacterial and MammalianMutationembedded I-Sce I TS from 163-185bp, truncated 25 …PromoterSFFVAvailable SinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Rainbow
Plasmid#206252PurposeExpression of 7 fluorescently labelled proteins in mammalian cells. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B (human); Actin, Tubulin (B. taurus); mito mCherry, GST mTagBFP1 (Synthetic); CyOFP1 (E. quadricolor); Ctnnb1 (mouse)
UseRecombinant baculovirus production (bac-to-bac)TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2-CAG::Palmbow
Plasmid#158993PurposeMulticolor membrane-restricted labeling with a genome-integrating Tol2 transposon vector (randomly expressing palmitoylated mCherry, mEYFP or mCerulean upon Cre recombination)DepositorInsertPalmbow
TagsThe default expressed EBFP2 is fused to H2B; oth…ExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.H2B.RFP
Plasmid#170387PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
LiPOP2
Plasmid#168266PurposeA single-component optogenetic tool for photoswitchable pyroptosisDepositorInsertmGSDMD(1-276) (Gsdmd Mouse)
TagscpLOV2, mCherryExpressionMammalianMutationR138A, K146A, R152A, R154APromoterCMVAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
Negative Control Binder
Plasmid#179140PurposeBinder: SspB that carries two point mutations reducing homodimerization(Y11K/A15E, residue numbering from pdb: 1ou9) and an additionional A70Q mutation greatly reduces affinity for SsrA peptideDepositorInsertSspB
TagsFLAG and mCherryExpressionMammalianMutationY11K/A15E, residue numbering from pdb: 1ou9. Addi…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC74
Plasmid#62342PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-FoxO1_1R_10A_3D
Plasmid#106278PurposeFluorescent fusion protein for FoxO1DepositorInsertsTagsClover fluorescent proteinExpressionMammalianMutationDeleted amino acids 401-636, S209A, H212R, S215A,…PromoterEF1a/RPBSAAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-TRIM21
Plasmid#207838PurposeInducible TRIM21 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsTagsweak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TC1316
Plasmid#164883PurposeCMV-bpNLS-dCas13d-bpNLS-ADARdd-mCherry, ADARdd embeded in loop3DepositorInsertdcas13d-ADARdd
ExpressionMammalianMutationdCas13d L560-G586 deletedPromoterCMV, T7Available SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
CIB-VP64 (B1016)
Plasmid#92037PurposeExpresses CIB1 (Full-length, with endogenous NLS) fused to VP64 activation domain (4xVP16 inserts)DepositorInsertCIB1-VP64 (CIB1 Mustard Weed)
TagsFusion of plant CIB1 with VP64 activation domain.…ExpressionMammalianPromoterCMVAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
cpLID-micro
Plasmid#168995Purposecircularly permuted LOV2 based optical dimerization system (ssrA-cpLOV2 and sspB)DepositorInsertmCh-sspB-T2A-cpLID-CAAX
ExpressionMammalianPromoterCMVAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCKC776
Plasmid#226627PurposepiggyBAC 4xHRE YB_TATA hCas9-T2A-G/C-biased1DepositorInserts4x HRE_YB TATA, SpCas9, oxygen-dependent degron, T2A, G/C-biased1 variant of TdT (DNTT S. pyogenes, Human)
EF1a promoter, mCherry
UseSynthetic BiologyTagsoxygen dependent degron (ODD)ExpressionMammalianPromoter4xHRE_YB TATA and EF1aAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
vYM133_PB-pEF-osTIR1-T2A-iaaH-T2A-mGFPmut3-mAID-iCasp9-T2A-mCh-AID-BlastR
Plasmid#160046PurposeFor expressing the full paradoxical circuitDepositorInsertsosTIR1
iaaH
iCasp9
BlastR
UseSynthetic BiologyTagsmAID, mCherry, and mGFPmut3ExpressionMammalianPromoterno promoter, T2A is used and pEF1sAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only