We narrowed to 6,763 results for: poly
-
Plasmid#160560PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M3_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM3_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_3-pTRNA-scf 2.1 (GB2073)
Plasmid#160558PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M1_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M2_3-pTRNA-scf 2.1 (GB2074)
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - C130S, E446C
Plasmid#60394PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) C130S, E446C for crosslinking polyglutamate peptideDepositorInsertTUB1 (TUB1 Budding Yeast, Synthetic)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTol2-HuC(elavl3)-CaMPARI2
Plasmid#137185Purposepan-neuronal expression of CaMPARI2 in zebrafish, used to generate the CaMPARI2 zebrafish line at ZIRC (ZL13801)DepositorInsertHuC(elavl3)-CaMPARI2-FLAG-HA-myc-polyA
UseTol2 plasmid for zebrafishTagsFLAG, HA, mycPromoterHuC(elavl3)Available SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSSRB274_pAC8-eGFP-hsCRBN
Plasmid#218791PurposeInsect cell expression vector for FLAG-TEV-eGFP-Prescission-hsCRBNDepositorInsertProtein cereblon (CRBN Human)
TagsFLAG-TEV-eGFP-PrescissionExpressionInsectMutationeGFP fused to N-terminusPromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSSRB069_pAC8-hsDDB1dB
Plasmid#218790PurposeInsect cell expression vector for 6xHis-TEV-hsDDB1∆BDepositorInsertDNA damage-binding protein 1 (DDB1 Human)
Tags6xHis-TEVExpressionInsectMutationDeleted amino acids 396-705 and replaced with GNG…PromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSDC803_IKZF1_mutant
Plasmid#224113PurposeInsect cell expression vector for IKZF1 mutant for CRBN cryoEM pre-blottingDepositorInsertIKZF1 (IKZF1 Human)
TagsFlag-TEVExpressionInsectMutationResidues 140-196, Q146A and G151NPromoterpolyhedrinAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Myo10
Plasmid#135403PurposeExpresses GFP-tagged bovine Myo10 in mammalian cells.DepositorInsertMyo10 (MYO10 Bovine)
TagsEGFPExpressionMammalianMutation"Relative to the GenBank Myo10 cDNA sequence…PromoterCMVAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-Bsu
Plasmid#163911PurposeExpresses Bsu large fragment for affinity purificationDepositorInsertBsu polymerase
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFL-EGFP-3xFlag-HLTF
Plasmid#193055PurposeBaculovirus expression of human HLTF for recombinant protein productionDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C-GFP
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
Tags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGHUC w-ERBIN (2-hybrid prey plasmid)
Plasmid#128163PurposeUV5 promoter drives expression of omega-erbin fusion. Pair with pB1H2 UV5 Zif268-cons as a positive control (turns on HIS3/GFP).DepositorInsertERBIN PDZ domain (ERBIN Synthetic)
UseSynthetic BiologyTagsFLAG and Omega subunit of RNA polymeraseExpressionBacterialPromoterUV5Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-GFP-dynein-2(D1091–Q4307)
Plasmid#64064PurposeCodon-optimized human dynein-2 motor domain (D1091–Q4307) for baculovirus expression. 6His-ZZ-GFP N-terminal tag, TEV site to cleave 6His-ZZ.DepositorInsertCytoplasmic dynein-2 (DYNC2H1 Human)
TagsGFP, His tag, and ZZ tagExpressionInsectMutationDeleted amino acids 1-1090, extra C-terminal vali…PromoterPolyhedrinAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-POMP-PSMG1-PSMG2-PSMG3-PSMG4
Plasmid#214137PurposeInsect cell expression of the human 20SCP proteasome assembly chaperonesDepositorInsertsExpressionInsectPromoterpolyhedrinAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSN840
Plasmid#184832PurposeExpresses human KIF5A(∆exon27) and human KLC1 in insect cellsDepositorUseCre/LoxTagsHis-FLAG and mScarlet-2xStrepIIExpressionInsectMutation∆exon27 form of human KIF5APromoterp10 and polyhedrinAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEW108
Plasmid#232823PurposeExpresses yeast compass complex in insect cellsDepositorInsertTagsHis6-3xFLAG, TwinstrepExpressionInsectMutationSet1(762-1080)Promoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only