We narrowed to 10,162 results for: tre promoter
-
Plasmid#120728PurposeExpression of a Flag-tagged version of DDX11 KAE mutant in mammalian cellsDepositorInsertDDX11 KAE mutant (DDX11 Human)
Tags3x FLAGExpressionMammalianMutationSubstitution of E201 and Y202 with K and APromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DDX11-Flag-KAK
Plasmid#120729PurposeExpression of a Flag-tagged version of DDX11 KAK mutant in mammalian cellsDepositorInsertDDX11 KAK mutant (DDX11 Human)
Tags3x FLAGExpressionMammalianMutationSubstitution of E201, Y202 and E203 with K, A and…PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
EW263 CMV-TO-ADAR2dd(E488Q, T501A)-PUF-9R(FLP-IN)
Plasmid#236126PurposePlasmid encoding ADAR2dd attached to PUF-9R under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd-PUF-9R (ADARB1 Synthetic, Human)
ExpressionMammalianMutationE488Q, T501A in ADAR2ddPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-VCF1 N167A
Plasmid#223019PurposeExpression of GFP-tagged VCF1 (p97 binding-deficient N167A mutant) in mammalian cells.DepositorAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-FLL[157-159]AAA
Plasmid#96994PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-FLL[157-159]AAA
Plasmid#96991PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.PAC
Plasmid#57828PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
EW267 CMV-TO-ADAR2dd(E488Q, T501A)-PUF-9R-MARIAcomp(V241D, H243M) (FLP-IN)
Plasmid#236127PurposePlasmid encoding ADAR2dd attached to PUF-9R with deimmunizing mutations under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd-PUF-9R (ADARB1 Synthetic, Human)
ExpressionMammalianMutationE488Q, T501A in ADAR2dd; V241D, H243M in PUF-9RPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only