We narrowed to 6,742 results for: ins/1000
-
Plasmid#74919PurposeMammalian expression of mKlf2 and mNanog-mCherryDepositorTagsT2A and mCherryExpressionMammalianPromoterCAGAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-Fc-His
Plasmid#72081PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
MPC1-AA-FLAG
Plasmid#228904PurposeExpression of mouse MPC1 in which K45 and K46 motif sites were replaced with alanine blocking acetylation with a C terminal FLAG tagDepositorInsertMPC1 (Mpc1 Mouse)
TagsFLAGExpressionMammalianMutationK45 and K46 motif sites were both replaced with a…PromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
ERAP1-rs27895(C)
Plasmid#206142PurposeExpresses the rs27895-C allele of ERAP1, myc-tagged.DepositorInsertERAP1 (ERAP1 Human)
Available SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
QKI-7 scFv [N183/15]
Plasmid#190536PurposeMammalian Expression of QKI-7 scFV. Derived from hybridoma N183/15.DepositorInsertQKI-7 (Mus musculus) recombinant scFV (Qki Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV mCgrrf1-V5
Plasmid#175128PurposeLentiviral expression of mouse Cgrrf1-V5DepositorAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-Fc-His
Plasmid#72082PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-Fc-His
Plasmid#72080PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam3-AP-His
Plasmid#71954PurposeExpresses the extracellular region of the JAM-3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.1-AP-His
Plasmid#71955PurposeExpresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam4.3-AP-His
Plasmid#71956PurposeExpresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFbxw7#1/Cre
Plasmid#173635PurposeExpresses a Fbxw7-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fbxw7 (Fbxw7 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFbxw7#2/Cre
Plasmid#173636PurposeExpresses a Fbxw7-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fbxw7 (Fbxw7 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
RN3P-KDM5B-FLAG
Plasmid#86398PurposeFLAG-tagged mouse KDM5B cDNA clone for mammalian cell expressionDepositorAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pL452(hygro)-Sf3b1-K700K
Plasmid#90426Purposeselectable HDR vector to introduce silent mutation (position 700) in mus Sf3b1 gene (for use with pL452-Sf3b1-K700E and sgSf3b1(T1) gRNA vectors enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_OMA1_WT
Plasmid#81889PurposeGateway Donor vector containing OMA1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_OMA1_p.P177S
Plasmid#81441PurposeGateway Donor vector containing OMA1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MPC1-QQ-FLAG
Plasmid#228905PurposeExpression of mouse MPC1 in which K45 and K46 motif sites were replaced with glutamine to mimic acetylated lysines with a C terminal FLAG tagDepositorInsertMPC1 (Mpc1 Mouse)
TagsFLAGExpressionMammalianMutationK45 and K46 motif sites were both replaced with g…PromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only