We narrowed to 7,782 results for: CCH
-
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 SATtoG KtoR
Plasmid#231861PurposeBacterial expression of N-terminally 6His tagged Gcn4 SATtoG KtoRDepositorInsertGcn4 SATtoG KtoR
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ANP1-FAPoptim
Plasmid#221120PurposeFAP-tagged marker for the cis-Golgi (FAP optimized for yeast expression)DepositorInsertANP1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-ERG6-FAPoptim
Plasmid#221121PurposeFAP-tagged marker for lipid droplets (FAP optimized for yeast expression)DepositorInsertERG6-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-PMA1-FAPoptim
Plasmid#221122PurposeFAP-tagged marker for the plasma membrane (FAP optimized for yeast expression)DepositorInsertPMA1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-SEC7-FAPoptim
Plasmid#221124PurposeFAP-tagged marker for the trans-Golgi (FAP optimized for yeast expression)DepositorInsertSEC7-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-VPH1-FAPoptim
Plasmid#221125PurposeFAP-tagged marker for the vacuolar membrane (FAP optimized for yeast expression)DepositorInsertVPH1-FAPoptim
ExpressionYeastPromoterTEF1Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00045
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED solvvol
Plasmid#231858PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoED solvvolDepositorInsertGcn4 ILVtoED solvvol
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterT7Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfB8156
Plasmid#175200PurposeXenopus oocyte expression vector containing yEGFP. Contains T7 RNA polymerase binding site, and adds polyA tail to yEGFP. Used for generation of mRNA, for injection into xenopus laevis oocytes.DepositorInsertyEGFP
UseMrna expression, injection into xenopus oocytesTagsPolyAPromoterT7Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEndo-I-OnuI-TSM
Plasmid#207954PurposeExpresses a fusion of the homing endonuclease I-OnuI with the thermosensitive L212P VMA1 intein. Endonuclease activity is restricted to lower temperatures.DepositorInsertThermosensitive fusion of I-OnuI and the L212P VMA1 intein.
UseSynthetic BiologyExpressionBacterialMutationLeucine 212 changed to proline, leucine 434 in fu…Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHis-WzzE
Plasmid#196661PurposeExpression of N-terminally His6-tagged WzzE from Pectobacterium atrosepticum in E.coliDepositorInsertWzzE
TagsTEV-cleavable His6ExpressionBacterialPromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGST-WzzE
Plasmid#196662PurposeExpression of N-terminally GST-tagged WzzE from Pectobacterium atrosepticum in E.coliDepositorInsertWzzE
TagsTEV-cleavable GSTExpressionBacterialMutationValine insertion at position 2.PromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHis-mCherry-WzzE
Plasmid#196663PurposeExpression of N-terminally His6-mCherry-tagged WzzE from Pectobacterium atrosepticum in E.coliDepositorInsertWzzE
TagsHis and mCherryExpressionBacterialMutationValine insertion at position 2 of WzzE.PromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPglL-strep-mCherry
Plasmid#196664PurposeExpression of C-terminally distrep tag II-mCherry-tagged PglL from Neisseria meningitidis in E.coliDepositorInsertPglL
TagsTEV-cleavable distrep tag II and mCherryExpressionBacterialPromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPglL-strep-mClover3
Plasmid#196665PurposeExpression of C-terminally distrep tag II-mClover3-tagged PglL from Neisseria meningitidis in E.coliDepositorInsertPglL
TagsTEV-cleavable di-strep tag II and mClover3ExpressionBacterialPromoteraraBADAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only