We narrowed to 21,293 results for: KIN
-
Plasmid#157639PurposeBatis maritima MHTDepositorInsertMHT
ExpressionBacterialAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
YIplac204-pOst1-ESCargo(Crimson)
Plasmid#140154PurposeExpresses a vacuolar cargo for yeast at the TRP1 locusDepositorInsertpOst1-APVNTT-DsRed-Express2-FKBP(FV)C22V-QRPL
ExpressionYeastPromoterTPI1Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMVd2-Dr-TrkB
Plasmid#127955PurposeMyr DrTrkA expression in mammalian cellsDepositorInsertMyr-3xSAG-Dr-hel4-TrkB
ExpressionMammalianAvailable SinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBW014
Plasmid#131817PurposeVector with aTc inducible M. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 55 and 56DepositorArticleInsertM. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 55 and 56
UseSynthetic BiologyAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW010
Plasmid#131812PurposeVector with aTc inducible M. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 35 and 36DepositorArticleInsertM. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 35 and 36
UseSynthetic BiologyAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW008
Plasmid#131809PurposeVector with aTc inducible M. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 30 and 31DepositorArticleInsertM. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 30 and 31
UseSynthetic BiologyAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW006
Plasmid#131807PurposeVector with aTc inducible M. laminosus Fd1 mutant with the estrogen recepor-ligand binding domain fused between amino acids 25 and 26DepositorArticleInsertMastigocladus laminosus ferredoxin mutant with the estrogen recepor-ligand binding domain fused between amino acids 25 and 26
UseSynthetic BiologyAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF738
Plasmid#122032PurposeEF1a-WNV-protease-GFPDepositorInsertsUseLentiviralAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLacI-LAP
Plasmid#115902PurposeBackbone for expressing LacI-LAP-fused proteins.DepositorTypeEmpty backboneUseLentiviralTagsEGFPAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWW2149
Plasmid#80392PurposeContains constitutive histidine kinase (pCon-Taz) with 4x SH3 scaffold domains.DepositorInsertTaz Histidine Kinase
UseSynthetic BiologyTagsFused by GS linkers to 4 SH3 domainsAvailable SinceOct. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK_proNR2_LGK.1
Plasmid#81161PurposeExpresses levoglucosan kinase variant LGK.1 with promoter proNR2DepositorInsertLevoglucosan kinase
TagsHis6xExpressionBacterialMutationLGK.1 (L140I,S142A,A373C)PromoterproNR2Available SinceSept. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK392
Plasmid#70236PurposeProtein production from a synthetic gene encoding Treponema denticola ATCC 35405 PurE-H40NDepositorInsertphosphoribosylaminoimidazole carboxylase
ExpressionBacterialMutationHis40AsnAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUASp YFP Rabx5 WT
Plasmid#53494DepositorInsertRabx5
TagsYFPExpressionInsectPromoterGAL4Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUASp YFP Rabx2 DN
Plasmid#53475DepositorInsertRabx2
TagsYFPExpressionInsectMutationS21NPromoterGAL4Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pKS100
Plasmid#24630DepositorInsertfadD
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 11, 2010AvailabilityAcademic Institutions and Nonprofits only