We narrowed to 10,449 results for: T7
-
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-ePhi29(+exo) (LM2995)
Plasmid#208966PurposeUnfused ePhi29 DNA polymerase (+exo), expressed from CMV or T7 promoters.DepositorInsertePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationePhi29(+exo)(M8R/V51A/M97T/G197D/E221K/Q497P/K512…PromoterCMV and T7Available sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET15-MHL
Plasmid#26092PurposeSGC Empty backbone for bacterial expression under T7 promoter. Uses infusion based cloning method.DepositorTypeEmpty backboneUseTags6xHis and TEV cleavage siteExpressionBacterialMutationPromoterT7-lacO (lactose/IPTG inducible)Available sinceSept. 6, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDual-eGFP
Plasmid#63215PurposeExpression of eGFP in bacteria and in mammalian cells. Used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationPromoterCMV-EF1α hybrid (CEF)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBA1015
Plasmid#189589PurposeT7gp1.7 deletion HR vector 250bp HR Arms (T7 phage editing)DepositorInsertT7gp1.7 Locus 250bp Homology Arms
UseSynthetic BiologyTagsExpressionBacterialMutationEncodes for a full deletion of T7gp1.7PromoterAvailable sinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET30b_OmpAT7Sav
Plasmid#138589PurposeT7-tagged streptavidin with native C-terminus and periplasmic export signal OmpA; controlled by PT7 promoter; KanR, pBR322 oriDepositorInsertT7-tagged streptavidin variant with native C-terminus and OmpA signal peptide for periplasmic export
UseSynthetic BiologyTagsOmpA export signal and T7 tagExpressionBacterialMutationPromoterPT7Available sinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTM1_NP_ZEBOV
Plasmid#69121PurposeEncodes for Ebola Virus Zaire NP under control of a T7 RNA polymerase promoterDepositorInsertNP ZEBOV (NP )
UseT7TagsExpressionMutationPromoterT7Available sinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTM1_VP35_ZEBOV
Plasmid#68121PurposeEncodes for Ebola Virus Zaire VP35 under control of a T7 RNA polymerase promoter.DepositorInsertVP35 ZEBOV (VP35 )
UseT7TagsExpressionMutationPromoterT7Available sinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTM1_VP30_ZEBOV
Plasmid#69119PurposeEncodes for Ebola Virus Zaire VP30 under control of a T7 RNA polymerase promoterDepositorInsertVP30 ZEBOV (VP30 )
UseT7TagsExpressionMutationPromoterT7Available sinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3E5E_luciferase
Plasmid#69358PurposeEncodes for Ebola Minigenome with luciferase reporter gene under control of a T7 RNA polymerase promoterDepositorInsert3E5E luciferase minigenome
UseT7TagsExpressionMutationPromoterT7Available sinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTM1_L_ZEBOV
Plasmid#69120PurposeEncodes for Ebola Virus Zaire L under control of a T7 RNA polymerase promoterDepositorInsertL ZEBOV (L )
UseT7TagsExpressionMutationPromoterT7Available sinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJin-290
Plasmid#125718PurposeABA-inducible split T7 gRNA for GFP vector using RNAPN d5-19 with CGG RNAP-CDepositorInsertPCGG-gRNA GFP-off expression, FKBP-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-FRB
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only