We narrowed to 80,471 results for: Mycs;
-
Plasmid#27064DepositorInsertP#38-luxA-FLAG-luxB-DAS+4
ExpressionBacterialAvailable SinceMay 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO SSA1
Plasmid#19462DepositorInsertSSA1 (SSA1 Budding Yeast)
ExpressionMammalianAvailable SinceOct. 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
L284F Cus2p
Plasmid#73059PurposeS. cerevisiae Cus2p gene with L284F MutationDepositorArticleInsertCUS2p (CUS2 Budding Yeast)
Tags6x His tag fused to TEV cleavage siteExpressionBacterial and YeastMutationLeucine 284 to PhenylalaninePromoterT7AvailabilityAcademic Institutions and Nonprofits only -
D282N Cus2p
Plasmid#73060PurposeS. cerevisiae Cus2p gene with D282N MutationDepositorArticleInsertCUS2p (CUS2 Budding Yeast)
Tags6x His tag fused to TEV cleavage siteExpressionBacterial and YeastMutationAsp 282 to AsnPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2
Plasmid#52961PurposeReplaces original lentiCRISPRv1 (Addgene Plasmid 49535) and produces ~10-fold higher titer virus. 3rd generation lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT57
Plasmid#223429PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYC1640
Plasmid#158719PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using zeocin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_BsmBI-sgRNA-BsmBI
Plasmid#188703PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and a BsmBI array for cloning 4 sgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNGN2-BSD-mApple
Plasmid#182308PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expression, bsd selection, mAppleInsertsTagsT2A-mycNLS-mAppleExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGH335_MS2-AID*Δ-Hygro
Plasmid#85406Purposelentiviral expression vector for MS2-AID*Δ fusion protein with hygromycin B selectable markerDepositorInsertMS2-AID*Δ and Hygromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBMN(CMV-copGFP-Puro-SMAR)
Plasmid#80391Purposeexpression copGFP and Puromycine, with an S/MAR element for episomal maintainceDepositorInsertcopGFP-T2A-Puromycine
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT51
Plasmid#223423PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for dicot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-LbCas12a-RRV-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUltra-5HTP
Plasmid#178042PurposeExpress modified ScTrpRS/tRNA for genetic incorporation of 5HTP to TAG codonDepositorInsertsModified ScTrpRS for 5HTP incoporation
suppressor tRNA for 5HTP incorporation
ExpressionBacterialMutationT107C, P254T, C255AAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-NFIA.1-SOX9 (bi-directional promoter)
Plasmid#182306PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into astrocytes via NFIA and SOX9 expressionUsePiggybacTagsNone and T2A-mycNLS-mTagBFP2ExpressionMammalianPromoterTRE3G-Bi-directionalAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE013
Plasmid#108681PurposeAll-in-one genome editing vector in M. polymorpha (hygromycin resistant)DepositorTypeEmpty backboneUseCRISPRAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only