We narrowed to 9,829 results for: pho;
-
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-All K-R
Plasmid#233094PurposeExpression of GST-YihI with all lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with all lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with all lysines (K) mutated to arginine…Available SinceMay 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAX1_Z11 gpN:SpyTag
Plasmid#225196PurposeUsed for adding C-terminal SpyTag to the Plesiomonas ZOR0011 P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS∆tum
Plasmid#225198PurposeUsed to create a markerless deletion of the E. coli HS tum geneDepositorInserttum homology arms
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_lexA(Ind-)
Plasmid#225199PurposeUsed to create a non-inducible lexA by introducing a G85D mutation in E. coli HSDepositorInsertlexA homology arms
ExpressionBacterialMutationlexA G85DAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_gpN:SpyTag
Plasmid#225193PurposeUsed for adding C-terminal SpyTag to the E. coli HS P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Dendra2-NS2B
Plasmid#204218PurposeExpresses Dendra2-NS2B in Mammalian / Mouse Cell LinesDepositorInsertDengue (Dengue Type 2) NS2B (POLY Dengue Virus Serotype , Strain NGC)
TagsDendra2ExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
2BT-His-TEV-cs-LC3b
Plasmid#197460PurposeBacterial Expression of human LC3bDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-PODXL S481D
Plasmid#195224PurposeMammalian expression vector containing GFP tagged Podocalyxin. PKC phosphomimetic mutant.DepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP8B2-HA
Plasmid#209227PurposeMammalian expression of ATP8B2DepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP8B2(E171Q)-HA
Plasmid#209254PurposeMammalian expression of ATP8B2 mutant E171QDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-hWIPI2B-3×FLAG
Plasmid#215510PurposeExpresses FLAG tagged human WIPI2B.DepositorInsertWD-repeat protein interacting with phosphoinositides 2B (WIPI2 Human)
UseRetroviralTags3×FLAGExpressionMammalianAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
ExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-PRF1-Exon3
Plasmid#209075PurposeTargeting vector for the human PRF1 locus to replace exon 3 with repaired exon 3DepositorInsertPRF1-Exon3 HDRT (PRF1 Human)
UseCRISPRAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF702
Plasmid#209650PurposeSuicide plasmid carrying a neomycin resistance marker flanked by homologous regions of the Mth60-fimbria encoding operon of Methanothermobacter thermautotrophicusDepositorInsertsDownstream homologous region
thermostable neomycin phosphotransferase gene
Upstream homologous region
Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMX-IG-ATG3 (H262A)
Plasmid#212027PurposeExpresses untagged ATG3 (H262A) in mammalian cellsDepositorAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-AncSZ
Plasmid#214235PurposeBacterial expression construct of AncSZ, an kinase domain engineered through ancestorial reconstruction of the kinase domains of both SYK and ZAP-70. For in vitro protein tyrosine phosphorylationDepositorInsertSyk kinase (SYK Human)
Tags6xHisExpressionBacterialMutationSequence gained through ancestral reconstruction …PromoterT7Available SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only