We narrowed to 26,851 results for: GFP
-
Plasmid#245050PurposeDistribution and localization of human wild-type GAP1 in cellsDepositorInsertGAP1
TagsGFPExpressionMammalianAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP Rab3a T36N
Plasmid#245014PurposeDistribution and localization of rat Rab3a T36N mutantDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shAtg7-EGFP
Plasmid#227684PurposeExpresses EGFP and shRNA targeting Atg7DepositorInsertAtg7 shRNA (Atg7 Mouse)
ExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Bach2_P2A_EGFP
Plasmid#242200PurposeExpresses Bach2 with GFP in mammalian cells.DepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2_Ubi_N41 CNBD AcGFP
Plasmid#241360PurposepMPS37; ubiquitously expresses cAMP sensor; zebrafish transgeneDepositorInsertUbi:CNBD-AcGFP
UseTol2 zebrafish transgene expression; gatewayTagsAcGFPAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin β1β6-EGFP
Plasmid#242826PurposeEncodes human integrin β1 chimera containing integrin β6 cytoplasmic domain and C-terminal EGFP tagDepositorInsertIntegrin subunit beta 1, transcript variant 1A (ITGB1 Human)
ExpressionMammalianMutationIntegrin β1 chimera containing the cytoplasmic ta…Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP6 57-98
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28(a)-p2c-eGFP
Plasmid#242758PurposeExpresses eGFP fluorophore with fused p2c targeting ligand for expression in E. coliDepositorInsertP2C-EGFP
ExpressionBacterialAvailable SinceSept. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2_Ubi_N41_R307Q CNBD AcGFP
Plasmid#241361PurposepMPS55; ubiquitously expresses cAMP sensor(cAMP-insensitive mutant control); zebrafish transgeneDepositorInsertUbi:CNBD_R307Q-AcGFP
UseTol2 zebrafish transgene expression; gatewayTagsAcGFPAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
MBP-GFP-RGG
Plasmid#242453PurposeExpresses the MBP-GFP-RGG fusion protein.DepositorInsertMBP-GFP-RGG
TagsHis and MBPExpressionBacterialPromoterT7Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GST-GFP-RGG
Plasmid#242454PurposeExpresses the GST-GFP-RGG fusion protein.DepositorInsertGST-GFP-RGG
TagsGST and HisExpressionBacterialPromoterT7Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin β6β1-EGFP
Plasmid#242829PurposeEncodes human integrin β6 chimera containing integrin β1 cytoplasmic domain and C-terminal EGFP tagDepositorInsertIntegrin subunit beta 6, transcript variant 1 (ITGB6 Human)
ExpressionMammalianMutationIntegrin β6 chimera containing the cytoplasmic ta…Available SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
phSyn2 sfGFP-RNF152
Plasmid#215374PurposeLentiviral expression of sfGFP-tagged lysosome membrane protein RNF152 under the neuron-specific human synapsin promoter.DepositorInsertRNF152 (RNF152 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_T11_EGFP-Responder
Plasmid#230051PurposeIt presents the T11 inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertT11_EGFP
ExpressionMammalianAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_TRE3VG_EGFP-Responder
Plasmid#230050PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of EGFP through the OPTi-OX platformDepositorInsertTRE3VG_EGFP
ExpressionMammalianPromoterGAAGACAATAGCAGGCATGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1-Pls2-sfGFP
Plasmid#205749PurposeExpresses sfGFP under IPTG inducible promoter Pls2 in high copy pTRKH2 gram-positive shuttle vector. Used in Lactobacillus gasseri. Medium/low strength.DepositorTypeEmpty backboneUseShuttle vector gram+ gram-ExpressionBacterialPromoterPls2 (Phyperspank mutant, IPTG inducible)Available SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-psfGFPcp-natMX6
Plasmid#240557PurposeTag S. pombe genes at 3' end (C-terminal end of protein) with circularly permuted superfolder GFP, codon-optimized for S. pombeDepositorInsertpsfGFPcp
ExpressionYeastAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only