We narrowed to 949 results for: GGCT;
-
Plasmid#75969Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pSico shMAPKAPK3 human
Plasmid#85661Purposeexpression of shRNA targeting human MAPKAPK3DepositorAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE C9orf4-GFP KI
Plasmid#131472PurposeEndogenous tagging of C9orf4: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75235PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (2/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
TPD52L3 gRNA (BRDN0001145193)
Plasmid#76952Purpose3rd generation lentiviral gRNA plasmid targeting human TPD52L3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME3 gRNA (BRDN0001147963)
Plasmid#76568Purpose3rd generation lentiviral gRNA plasmid targeting human NME3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiX2-PURO-shDIXDC1-Ms-57
Plasmid#61232PurposeLentivirus expressing shRNA to mouse DIXDC1DepositorInsertDixdc1 (Dixdc1 Mouse)
UseLentiviralAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgPOU5F1
Plasmid#242174PurposeA piggybac-based vector containing mouse U6 promoter-driven POU5F1sgRNA and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d sgCiPELO #1
Plasmid#228932PurposeExpression of dCas9-KRAB and sgRNA targeting PELODepositorInsertPELO gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA074
Plasmid#215933PurposeFragmid fragment: (guide cassette) Tet-regulatable guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertH1-2xTetO_v1; DR_v0 [EnAs]; sgCD4_v1 [EnAs]; DR_v1 [EnAs]; sgCD4_v2 [EnAs]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA021
Plasmid#215929PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [EnAs]; sgCD4_v1 [EnAs]; DR_v1 [EnAs]; sgCD4_v2 [EnAs];
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA083
Plasmid#215934PurposeFragmid fragment: (guide cassette) reverse orientation; guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0 [EnAs]; sgCD4_v1 [EnAs]; DR_v1 [EnAs]; sgCD4_v2 [EnAs]}
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2702-AGER-gRNA1
Plasmid#216471Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L2_sgRNA1
Plasmid#201602PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L2 (LUC7L2 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only