We narrowed to 7,669 results for: CCH
-
Plasmid#222473PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 1). Variant 1 is chr10:128568698-A-G where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 1) (LOC110120928 Human)
UseLuciferaseMutationVariant 1 is chr10:128568698-A-G where the inform…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseMutationVariant 3 is chr10:128569437-G-A where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.2
Plasmid#222474PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 2). Variant 2 is chr10:128569418-T-C where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 2) (LOC110120928 Human)
UseLuciferaseMutationVariant 2 is chr10:128569418-T-C where the inform…Available SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRP[CRISPR]-EGFP/Puro-hCas9-U6>(long left)-U6>(long right)
Plasmid#216871PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, gRNA Long.L, gRNA Long.R (Dmd Mouse)
UseCRISPRMutationmdx mutation in mouse dystrophinAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha/beta into TRBC1 HDRT Source (pTR 262)
Plasmid#112022PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-betaDepositorInsertNYESO alpha/beta into TRBC1 HDRDT
UseCRISPR and Synthetic BiologyAvailable SinceNov. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAMS823 His6-MBP-3C-ORF2p (238-1061, ORFeus-Hs) in pET41
Plasmid#213024PurposeExpresses human LINE-1 ORF2p Core (238-1061) in E. coli as an N-MBP fusionDepositorInsertLINE-1 ORF2p (238-1061)
TagsHis6-MBP-3CExpressionBacterialPromoterT7 / LacAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha into TRAC HDRT Source (pTR 223)
Plasmid#112023PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-alpha with 1G4 NYESO TCR-alphaDepositorInsertNYESO alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta into TRBC1 HDRT Source (pTR 277)
Plasmid#112024PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-beta with 1G4 NYESO TCR-betaDepositorInsertNYESO beta into TRBC1 HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K206R-VA
Plasmid#191224PurposeLentiviral expression of human IFIT5_K206R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTags3xFlag-TEVx2-6xHis-Strep x2 tag and VA tagExpressionMammalianMutationchanged Lysine 206 to Arginine (K206R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT646 human L1 ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro
Plasmid#213026PurposeExpresses full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only