We narrowed to 10,323 results for: epo
-
Plasmid#103860PurposeHeterologous, cobalt-inducible expression of SQE1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertsqualene epoxidase 1 (XF1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted gene is codon optimized. 2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2+Brd9 (zebrafish) partial UTR and coding sequence-EGFP
Plasmid#248787Purposefuse partial UTR and coding sequence of Brd9 (zebrafish) with EGFP reporterDepositorInsertbrd9 (brd9 Zebrafish)
UseBrd9(zebrafish)-egfp reporterTagsEGFPPromoterpartial 5'UTR sequence of zebrafish brd9Available SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitRatioGFP:LAAQ
Plasmid#240451PurposeExpression of indicator protein fusion (modified ratiometric pHluorin & low affinity Aequorin) for monitoring calcium concentrations and pH in cell walls of higher plants. See Resource Information.DepositorInsertFusion of chitinase signal, soluble modified ratiometric pHluorin and low affinity Aequorin (D119A)
ExpressionBacterial and PlantMutationRatiometric GFP (ratiometric pHluorin) (PMID 9671…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
STIM1-RspA-NFAST
Plasmid#233606PurposeExpression of hSTIM1-RspA-NFASTDepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc LifeactΔC4-msfGFPΔN7
Plasmid#231555PurposeMammalian expression of C-terminally truncated Lifeact fused to N-terminally truncated monomeric superfolder GFP for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-MARINA
Plasmid#223328PurposeDONOR vector for genomic integration of MARINA voltage sensitive indicator gene from Platisa et al., 2017 (10.1021/acschemneuro.6b00234).DepositorInsertsMARINA
KIR2.1 channel Golgi-to-plasma membrane trafficking signal
UseCRISPR and Synthetic BiologyTagsmCherry and super-ecliptic pHluorinExpressionMammalianPromoterCAGAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL.BMI1
Plasmid#224711PurposeExpresses N-terminal hexahistidine-tagged human BMI1 (PCGF4) in insect cells.DepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Actin-Vhh-sfGFP-P2A-1xHA-iRFP-caax (JDW 1216)
Plasmid#224496PurposeGateway compatible middle entry clone containing an Actin nanobody fused to sfGFP followed by P2A and iRFP-caax tag (GFP actin reporter and cell membrane iRFP reporter)DepositorInsertActin-Vhh-sfGFP-P2A-HA-iRFP-caax
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL025 AAVS1-9xTetO-RSV-IGKleader-Cas9site-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA
Plasmid#188743PurposeDonor vector for integrating RSV promoter-driven dual surface marker/mCitrine fluorescent reporter at AAVS1 locusDepositorInsertSurface marker and mCitrine reporter
UseSynthetic BiologyExpressionMammalianPromoterRSVAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only