We narrowed to 4,420 results for: Erf
-
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Luciferase shRNA-TRE
Plasmid#225339PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertLuciferase shRNA (LOC116160065 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-856
Plasmid#218014PurposesfGFP fluorescent proteinDepositorInsertsfGFP
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
GL4.10 E2E1- Prg4 promoter-luciferase
Plasmid#195035PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertPrg4 promoter plus Enhancer 1 and Enhancer 2 (PRG4 Bovine)
UseLuciferaseAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 E3E2E1-Prg4 promoter-luciferase
Plasmid#195036PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertPrg4 promoter plus Enhancer 1, Enhancer 2, and Enhancer 3 (PRG4 Bovine)
UseLuciferaseAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 E4E3E2E1-Prg4 promoter-luciferase
Plasmid#195037PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertpGL4.10 E4E3E2E1-Prg4 promoter-luciferase (PRG4 Bovine)
UseLuciferaseAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-MOORmut
Plasmid#198213PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 32 amino acids containing a non-permissible minimum optimal O-linked recognition site (MOORmut) followed by a 6x-His tagDepositorInsertsfGFP_MOORmut
Tags6x His Tag and mutated (non-permissible) MOORmut …ExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_PARRC_150-189 (pBS0658)
Plasmid#185201PurposeFor the mammalian expression of the tardigrade protein CAHS1_PARRC_150-189. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_PARRC_150-189
ExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_A234G (pBS0816)
Plasmid#185267PurposeFor the mammalian expression of the human protein APOE_HUMAN_A234G. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_A234G
ExpressionMammalianMutationA234GAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only