We narrowed to 788 results for: f10
-
Plasmid#228348PurposeConstitutive rPhlTA mutant expressionDepositorInsertphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT478
Plasmid#228286PurposeConstitutive mutant rPhlTA expression with strong promoterDepositorInsertrphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-RSET-iGABASnFR2(no bind)-6xHis
Plasmid#218887PurposeBacterial expression of improved GABA sensor control (no change in fluorescence)DepositorInsertiGABASnFR2(no bind)
Tags6xHisExpressionBacterialMutationS99A F102G R168PPromoterT7Available SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ROR1-COMP5AP-AviTag-9xHis
Plasmid#157374PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET22b-ecDHFR-D27S/Y100F
Plasmid#110827PurposeBacterial expression of E.coli DHFR D27S/Y100F mutantDepositorInsertecDHFR
ExpressionBacterialMutationD27 mutated to S27, Y100 mutated to F100PromoterT7Available SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMYA5tnT/pDEST26-N-FLAG
Plasmid#98131PurposeExpress CMYA5 (aa 3859 – 4069) Leu allele (4063) with a N-terminal FLAG tag in pDEST26 mammalian expression vectorDepositorInsertCMYA5 (CMYA5 Human)
TagsFLAGExpressionMammalianMutationrs10043986 (NM_153610.4:c.12188C>T)PromoterCMVAvailable SinceAug. 3, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG415Gal_Gcn4 WTSLFD
Plasmid#232980PurposeGalactose iduced expression of Gcn4 WTSLFD+ in yeastDepositorInsertGcn4 WTSLFD+
Tags3xHA and TEV cleavage siteExpressionYeastMutationF108W, E109T, Y110S, E111L, N112F, L113DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 S/ArotoL
Plasmid#232979PurposeGalactose iduced expression of Gcn4 S/ArotoL in yeastDepositorInsertGcn4 S/ArotoL
TagsTEV cleavage siteExpressionYeastMutationS101L, S104L, F108L, Y110L, S117L, S136L, S144LPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRC2 CTF-FLAG
Plasmid#217685PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertCELSR2 (CELSR2 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-2356Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2_untagged-Puro
Plasmid#192002PurposeLentiviral vector to generate LYSET(TMEM251)-isoform2 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_I142V-Puro
Plasmid#192004PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_R45W-Puro
Plasmid#192003PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ROR1 gRNA (BRDN0001162233)
Plasmid#76044Purpose3rd generation lentiviral gRNA plasmid targeting human ROR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IDNK gRNA (BRDN0001146514)
Plasmid#75865Purpose3rd generation lentiviral gRNA plasmid targeting human IDNKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IDNK gRNA (BRDN0001147773)
Plasmid#75866Purpose3rd generation lentiviral gRNA plasmid targeting human IDNKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IDNK gRNA (BRDN0001148428)
Plasmid#75867Purpose3rd generation lentiviral gRNA plasmid targeting human IDNKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pES004 (pTet-qacR 5)
Plasmid#69033PurposeqacR 5 downstream of a Tet promoterDepositorInsertqacR (qacR Synthetic)
TagsHis6 tagExpressionBacterialMutationW61Y, E90Q, F102S, M116Q, Y119L, E120QPromoterpTetAvailable SinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE
Plasmid#218873PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2(no bind)
UseAAVExpressionMammalianMutationS99A F102G R168PPromoterGFAPAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-flex-iGABASnFR2n-WPRE
Plasmid#218881PurposeAAV-mediated expression of improved GABA sensor (negative change in fluorescence)DepositorInsertiGABASnFR2n
UseAAV and Cre/LoxExpressionMammalianMutationS99A F104H R168PPromoterCAGAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only