We narrowed to 8,240 results for: 11
-
Plasmid#1721DepositorTypeEmpty backboneTagsEGFPN, EGFPC, IVSL, myo3-2341, myo3TsaExpressionWormAvailable sinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pTR01F/hFGFR2b-V5
Plasmid#236014Purposefor PiggyBac mediated integration and stable expression of hFGFR2b proteinDepositorAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-HA-mCherry-pA
Plasmid#233029PurposeTo Express HA Tagged hfCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInserthfCas13d-mCherry
UseAAVTagsmCherryAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DjCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233033PurposeTo Express HA tagged DjCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertDjCas13d and mCherry
UseAAVTagsmCherryAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-HA-mCherry-pA
Plasmid#233030PurposeTo Express HA tagged DjCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInsertDjCas13d-mCherry
UseAAVTagsmCherryAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-HA-mCherry-pA
Plasmid#233028PurposeTo Express HA tagged CasRX-mCherry fusion protein from the mammalian EFS promoterDepositorInsertCasRx-mCherry
UseAAVTagsmCherryAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233034PurposeTo Express HA tagged hfCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInserthfCas13d and mCherry
UseAAVTagsmCherryAvailable sinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-CASPR2 [K67/11R]
Plasmid#206606PurposeMammalian Expression Plasmid of anti-CASPR2 (Human). Derived from hybridoma K67/11.DepositorInsertanti-CASPR2 (Homo sapiens) recombinant Mouse monoclonal antibody (CNTNAP2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWzl_CRKL-Y207F+W275L
Plasmid#196022PurposeExpresses CRKL Y207F + W275LDepositorInsertCRKL
UseRetroviralAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWzl_CRKL-W275L
Plasmid#196019PurposeExpresses CRKL W275LDepositorInsertCRKL
UseRetroviralAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3_CRKL-Y207F-V5
Plasmid#196016PurposeExpresses CRKL Y207F, V5 taggedDepositorInsertCRKL
UseLentiviralExpressionMammalianAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv2.1 K+ channel [D4/11R]
Plasmid#188179PurposeMammalian Expression Plasmid of anti-Kv2.1 K+ channel (Rat). Derived from hybridoma D4/11DepositorInsertanti-Kv2.1 K+ channel (Rattus norvegicus) recombinant mouse monoclonal antibody (Kcnb1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hRSK3(RPS6KA2)
Plasmid#180384Purposelentiviral transduction of human RSK3 (RPS6KA2) geneDepositorAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv2.1 K+ channel [L83/11R]
Plasmid#177490PurposeMammalian Expression Plasmid of anti-Kv2.1 K+ channel (Rat). Derived from hybridoma L83/11.DepositorInsertanti-Kv2.1 K+ channel (Rattus norvegicus) recombinant mouse monoclonal antibody (Kcnb1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable sinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSAM2_mCherry_Mesp2
Plasmid#72693PurposeDoxycyline regulated expression of Mesp2 in mammalian cellsDepositorAvailable sinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pE-SUMO_PspCas13b
Plasmid#252295PurposeExpresses PspCas13b (WT) in bacterial cells.DepositorInsertPspCas13b (WT)
ExpressionBacterialMutationWTAvailable sinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSTTa
Plasmid#248647PurposeE. coli protein expression vector encoding 2x N-terminal StrepII tags flanking an 11 residue flexible linker, thrombin and TEV protease sites, and an optional C-terminal FLAG tag.DepositorTypeEmpty backboneTags2x StrepII, Thrombin site, TEV site and FLAGExpressionBacterialAvailable sinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
His-13bCTS-GFP
Plasmid#247243PurposeA bacterial expression plasmid encoding ciliary targeting sequence of mammalian Arl13b (amino acids 347-363) with N-terminal His and GFP-taggedDepositorInsertArl13B (ARL13B Human)
Tags6xHis and EGFPExpressionBacterialMutationdeleted amino acid 1-346,364-428PromoterT7 PromoterAvailable sinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only