We narrowed to 6,910 results for: crispr cas9 plasmids
-
Plasmid#126889PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ HDT701
Plasmid#126898PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ ERF922
Plasmid#126893PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_CMV-AcrIIA5_cpGR2(GGS5)-N77
Plasmid#246048PurposeExpression of AcrIIA5-cpGR2 hybrid in mammalian cells; insertion before N77; enables chemogenetic control of SauCas9; contains ITRs for AAV packaging with Rep2DepositorInsertAcrIIA5_cpGR2-N77
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCUX1.1.0-gDNA
Plasmid#112434PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CUX1DepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAZ.1.0-gDNA
Plasmid#112455PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MAZDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only