We narrowed to 23,621 results for: promoter
-
Plasmid#202003PurposeGenerates lentiviral vector for autochthonous KP-HELLO tumor initiation by intratracheal administration to KP miceDepositorInsertHELLO-T2A-Cre
UseLentiviralTagsFLAGPromoterpGKAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-eGFP
Plasmid#62518PurposeExpresses GFP under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing procedures.DepositorInserteGFP
UseAAVExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-FADD-DD
Plasmid#58263PurposeLentiviral vector for expressing a truncated form of FADD (lack of death effector domain) in mammalian cellsDepositorInsertFADD (FADD Human)
UseLentiviralExpressionMammalianMutationversion of FADD (FADD-DD) that contains the FADD …Available SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPV-TetO-SpCas9-GR-iC-ERiP (CRONUS-Puro)
Plasmid#100596PurposepiggyBac vector expressing Dual-regulated Cas9 (Puro resistance)DepositorInsertsCRISPR Cas9 fused with human Glucocorticoid Receptor
mCherry
rtTA-M2
UsePiggybac vectorExpressionMammalianMutationCodon-optimized for human codon usagePromoterDox-inducible TetO promoter and Human EEF1A1 prom…Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shSNAI1
Plasmid#115467PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-mCherry-STIM1
Plasmid#114176PurposeGateway entry clone containing mCherry-STIM1DepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-Rab8a-DN (T22N)
Plasmid#101049PurposeExpresses HA-tagged human Rab8-DN (T22N) in mammalian cellsDepositorAvailable SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX317 CALM2
Plasmid#193684PurposeConstitutive lentiviral expression of CALM2DepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRPF3
Plasmid#65383PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLEX303-ARF6-mNeonGreen
Plasmid#162027PurposeExpression of tagged ARF WTDepositorInsertARF6 (ARF6 Human)
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL410-BRN2p
Plasmid#110733PurposeLuciferase reporter for the human BRN2 promoterDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
LZRS-Flag_EZH2_ER
Plasmid#26111DepositorAvailable SinceJan. 31, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-PDGFRA-reporter
Plasmid#136456PurposeMammalian fluorescent reporter plasmid for PDGFRA signaling.DepositorInsertsPDGFRalpha (PDGFRA Human)
Array of serum response elements (SRE) to drive destabilized GFP expression from a minimal promoter.
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianPromoterCMV and Minimal promoter with artificial SRE enha…Available SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTarget: Ptaq-RFP_PlacIq-GFP
Plasmid#192280PurposeRFP expressed under constitutive promoter Ptaq and GFP expressed under constitutive promoter PlaciqDepositorInsertsRFP
GFP
ExpressionBacterialPromoterPlacIq and PtaqAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only