We narrowed to 71 results for: tfg
-
Plasmid#144896PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETcon-pGAL1-Aga2-Amyloid β42-c_myc
Plasmid#225223PurposeYeast optimized human Amyloid β42 fused with aga2 protein gene under gal1 promoter for the expression of Amyloid β42 in yeast surface display.DepositorTagsHA Tag and c-myc TagExpressionYeastPromoterGAL1Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
APP_pcDNA6.2/EmGFP-Bsd
Plasmid#176954PurposeMammalian expression vector encoding APP and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-TGFa-mNeonGreen
Plasmid#209913PurposeTo monitor the expression of TGFα, the plasmid encodes a recombinant TGFα fused intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-TGFa-ScNeo
Plasmid#209904PurposeTo monitor the status of TGFα, the plasmid encodes a recombinant TGFα fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertTGFa-ScNeo (TGFA Human)
TagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-TGFa-ScNeo
Plasmid#209908PurposeTo monitor the status of TGFα, the plasmid encodes a recombinant TGFα, fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertTGFa-ScNeo (TGFA Human)
TagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
APP_pCSdest
Plasmid#53877DepositorAvailable SinceMarch 27, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPBbleo-TGFa-EREG-ScNeo
Plasmid#209915PurposeTo express the chimeric protein of TGFα and EREG, which a recombinant TGFα protein fused extracellularly to the mScarlet and a recombinant Epiregulin protein fused intracellularly to the mNeonGreenDepositorTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-APP-CTF
Plasmid#181732PurposeGalactose inducible expression of APP-CTFDepositorAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_Tre3g_SBP_Halo_APP_SNAPf_CMV_SS_Strp_staygold_KDEL
Plasmid#251346PurposeSimultaneous expression of APP fused at N-term with Streptavidin binding protein (SBP) and HaloTag and SnapTag at C-term and ER-retained streptavidin fused to StayGold. Lentiviral backbone.DepositorInsertAPP (APP Human)
UseLentiviralTagsHaloTag, SBP, and SnapTagExpressionMammalianPromoterTre3GAvailable SinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only