We narrowed to 8,449 results for: reporter
-
Plasmid#29028PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle201 (SLC6A5 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1
Plasmid#173947PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 from SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
MI-Luciferase
Plasmid#75018PurposeEncodes the expression of Luciferase (with out any fluorescent reporter)DepositorInsertfirefly Luciferase
UseLuciferase and RetroviralAvailable SinceMay 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mIL6R
Plasmid#60797PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains IL6R 3' UTR and mutated miR-155 sitesDepositorInsertIL6R 3'UTR and mutated miR-155 binding site (IL6R Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-mouseEC1.45
Plasmid#173972PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertMouse orthologous SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS1401
Plasmid#29198PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP reporterDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-miR-375-mutA-E
Plasmid#53754PurposeLuciferase reporter assay for CIP2A with point mutation on miR-375 binding sitesDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseMutationMutation on miR-375 binding site A-E (refer to ci…Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-nAChr-beta3-CFP
Plasmid#50485Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChRBeta3 subunit, isoform 1 (Chrnb3 Mouse)
TagsCFPExpressionMammalianMutationCFP fusion in M3-M4 loop (after residue P379). O…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1538
Plasmid#29261PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving a lacZ reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
LentiX-(loxPcon-TET-DIAL-YB-TATA)-mCherry-HRasG12V-bGH-EFS-rtTA-TagBFP-WPRE
Plasmid#246367PurposeloxPcon TET-DIAL Reporter Lentivirus with YB_TATA expressing mCherry-HRasG12V in the presence of DOX and rtTA and editable by Cre recombinase. Contains rtTA-TagBFP expressed divergenty.DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
DDT Wnt
Plasmid#248843PurposeDouble Death Trap (DDT) Wnt reporter Containing FKBP12(F36V)-ΔCaspase9 (FC) and Puromycin Resistance Gene for Assessing Wnt SignalingDepositorInsert7xTCF binding element
UseLentiviralPromoter7xTCF binding element & minimal TATA-box prom…Available SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-CMV-Flag-SREBP-1c
Plasmid#237348PurposeAdenoviral-SREBP-1c cleavage-activation reporter systemDepositorAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 promEXOC3
Plasmid#205467PurposeLuciferase reporter of promoter activityDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lsl-EGFP-nls-mCherry:fli1aep-CreI-zf1-BFP (JDW 1236)
Plasmid#229816PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with fli1-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseTol2 based expression vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Hsp70-H2B-mCerulean-lsl-mScarlet-fli1-zCre-I-BFP (JDW 1233)
Plasmid#229841PurposeA Tol2 based expression vector with the Hsp70 promoter driving a cre dependent switch reporter. Contains an endothelial driven creDepositorInsertloxp-H2B-mCerulean-2xStop-loxP
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn T21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
Plasmid#225591PurposeAAV transgene plasmid with hSyn promoter for expression of catalytically dead TRIM21 RING(I18R+M72E)-F8.2(S54L+T127A) anti-tau degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
UseAAVTagsmCherryExpressionMammalianPromoterhSynAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC(Δ1-143)-GFP-IRES-mCherry (ΔTAD)
Plasmid#231233PurposeMYC stability reporter construct with deletion of the N-terminal region (residues 1-143) for transient expression in mammalian cellsDepositorInsertMYC (MYC Human)
ExpressionMammalianMutationTAD deleted (delta1-143); numbering based on sequ…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-VEGF120-T2A-mCherry
Plasmid#229134PurposeRetrovirus driving overexpression of VEGF120 plus mCherry reporterDepositorAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only