We narrowed to 11,081 results for: AGA
-
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Rac4
Plasmid#126896PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ ERF922
Plasmid#126893PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_mKate2_synCoTC
Plasmid#199469PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-GFP-T(WT)
Plasmid#181736Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700-mouse-TTN-Cerulean
Plasmid#128325PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorInsertgRNA against mouse TTN for activation
ExpressionMammalianAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA_2_mKate2_synCoTC
Plasmid#199471PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_2_mTagBFP2_synCoTC
Plasmid#199474PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_mTagBFP2_synCoTC
Plasmid#199472PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426TEF-LptTPS-A
Plasmid#89468PurposeExpression of prespatane synthase LptTPS-A in S. cerevisiae for sesquiterpene productionDepositorInsertLptTPS-A
TagsnoneExpressionYeastPromoterpBR322 origin of replication for propagation in E…Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_mKate2_synCoTC
Plasmid#199470PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_mTagBFP2_synCoTC
Plasmid#199473PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-FLAG-HA-T(WT)
Plasmid#181737Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available SinceAug. 3, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
GAPDH shRNA #1
Plasmid#32621DepositorInsertGAPDH shRNA #1
UseRNAiAvailable SinceJan. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pICSL61003
Plasmid#245680PurposeLevel 0 Golden Gate part 3' Extensin-Full length-IEU (TerP1) terminator P1, GCTT - TAGADepositorInsert3' Extensin-Full length-IEU (TerP1) terminator P1
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL62002
Plasmid#245683PurposeLevel 0 Golden Gate part3' Extensin-Full length (TerP2) terminator P2, TAGA - CGCTDepositorInsert3' Extensin-Full length (TerP2) terminator P2
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ14-PB-U6-ND1-acti-gRNA3
Plasmid#131058PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shATF4 #1
Plasmid#242702PurposeshRNA knockdown human ATF4 geneDepositorInsertATF4 (ATF4 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only