We narrowed to 60,692 results for: tra
-
Plasmid#123188Purposebinary plant vector for transient fLUC (with intron) expressionDepositorInsert2x35S::fLUC-I::tNOS and VirGN54D in the vector backbone
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF1304
Plasmid#144293PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
NET37 pmRFP-N2 (450)
Plasmid#61980Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NES-tdTomato-LINuS-WPRE
Plasmid#159894PurposeAAV expression of tdTomato fused to LINuS, a light-inducible nuclear localization signalDepositorInsertNES-tdTomato-LINuS
UseAAVExpressionMammalianPromoterEF1α promoterAvailable SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
TAPBPL pEGFP-C3 (1765)
Plasmid#62055Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-V5-Mfsd10
Plasmid#120238PurposeExpresses V5-tagged Mfsd10 in lentiviral vectorDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
aRJ_00134_PGK-mNeonGreen-syn_pA-EF1alpha-TagBFP-syn_pA
Plasmid#252538PurposeConstitutive promoters with downstream tandem syntax for PiggyBac integrationDepositorInsertTagBFP
ExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), hPGK (hu…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
aRJ_00135_EF1alpha-TagBFP-syn_pA-PGK-mNeonGreen-syn_pA
Plasmid#252539PurposeConstitutive promoters with upstream tandem syntax for PiggyBac integrationDepositorInsertTagBFP
ExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), hPGK (hu…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only