We narrowed to 19,450 results for: cat
-
Plasmid#186156PurposesgRNA targeting murine Msh2 geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMsh2_gRNA (Msh2 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
HT111_Fsyn_FAS(Cre off)_QuasAr6a_Citrine
Plasmid#178824PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6a_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Gluc-EL222-his
Plasmid#172097PurposeExpresses the fusion protein of Gluc and the light-activated transcription factor EL222 in bacteriaDepositorInsertGaussia Luciferase - EL222
ExpressionBacterialMutationGluc mutations - M43L, M110LPromoterT7Available sinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop A
Plasmid#171776PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-SpyTag003 Loop A
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues V…PromoterT7Available sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
SNX25-PX (506-628)
Plasmid#119104PurposeBacterial expression of human phox homology (PX) domain, SNX25-PX (506-628)DepositorAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS313-PRP8
Plasmid#89966Purposecomplements prp8 genomic deletionDepositorAvailable sinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458-gR2A_ISO
Plasmid#124808PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a> plasmids to convert expression of rat IgG2a hybridomas to isotype of choice.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthSPCas9
Tags3XFLAG and GFPExpressionMammalianAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMLS235
Plasmid#73683PurposeSapTrap 3-site Destination vector for C-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxExpressionWormAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-Laforin Myc R171H
Plasmid#84671Purposemammalian expression and/or retrovirus preparationDepositorPublicationAvailable sinceNov. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5X-BRT17
Plasmid#67000PurposeExpresses malE-BRT17 in E. coliDepositorInsertmalE-BRT17
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable sinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5X-Dros16
Plasmid#67004PurposeExpresses malE-Dros16 in E. coliDepositorInsertmalE-Dros16
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable sinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5X-CLP3.7
Plasmid#67011PurposeExpresses malE-CLP3.7 in E. coliDepositorInsertmalE-CLP3.7
TagsHis6 and malE-Factor XaExpressionBacterialPromotertacAvailable sinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 CTNNB1
Plasmid#67119PurposeStandard for cell-free expression benchmarking.DepositorAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A(KaganF58)
Plasmid#52001PurposeExpresses the human MAVS CDS containing the point mutation M1ADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMAVS
ExpressionMammalianMutationchanged Met 1 to AlaAvailable sinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAGGs-Hoxc8
Plasmid#45555DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHoxc8 (HOXC8 Chicken)
PromoterCMV / b-actinAvailable sinceAug. 5, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PL06008A2C06 (smedwi2)
Plasmid#35698DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSmedwi2
PromoterT7 sense, T3 antisenseAvailable sinceApril 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
p230 pCMVe-betaAc-luc
Plasmid#8391DepositorInsertCMVe-betaAc
UseLuciferaseExpressionMammalianAvailable sinceDec. 29, 2005AvailabilityAcademic Institutions and Nonprofits only