We narrowed to 19,058 results for: cat
-
Plasmid#224580PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 in mammalian cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pPB-cT3G-cERP2-DLX5
Plasmid#222927PurposePiggyBac transposon plasmid for doxycycline inducible expression of DLX5DepositorInsertDLX5 (DLX5 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOCC120-MBP-DDX3X-monoGFP-His
Plasmid#219985PurposeDDX3X(WT) protein purificationDepositorAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCherry-C1-ORP5-H478-9A-deltaTMD-FKBP
Plasmid#220075Purposeexpresses a mutant ORP5 that is unable to bind to PI4P with an mCherry fluorophore and an FKBPDepositorAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-oROS-HT
Plasmid#216416PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the extracellular site of cell membranes.DepositorInsertpDisplay-oROS-HT
ExpressionMammalianPromoterCMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDKN1A (p21) targeting gRNA
Plasmid#215319PurposeExpresses gRNA targeting CDKN1A (p21) and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIBA2-Int-SpyTag
Plasmid#198038PurposeExpression plasmid for producing SpyTagged stalled secretion variant of intiminDepositorInserteaeA
TagsSpyTagExpressionBacterialMutationlacks native signal peptide (amino acids 1-39)PromotertetAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
RGG-BcLOV-mCh-EGFR
Plasmid#208280PurposeExpresses RGG-BcLOV-EGFR for optogenetic activation of EGFR signaling. Includes an mCherry tag.DepositorInsertRGG-BcLOV-mCh-EGFR
UseLentiviralMutationH225N in mCherry- please see depositor commentPromoterpCMVAvailable SinceJan. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRAM1-EGFP
Plasmid#210365PurposeExpresses TRAM1 fused with EGFP in mammalian cellsDepositorAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
GLG1-EGFP
Plasmid#210372PurposeExpresses GLG1 fused with EGFP in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATG9A-2STrep
Plasmid#210359PurposeExpresses ATG9A fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FRT-JEDI-1P-Kv-WPRE
Plasmid#202617PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P flanked by FRT in AAV production vector expressed under the mammalian promoter (EF1a), FLP recombinase-dependentDepositorInsertFRT-JEDI-1P-Kv
UseAAV; Flp/frtExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS102 pHAGE2 CMVtetO2 TagBFP-P2A-ALFA-22xGS-SUMOstar-MCS
Plasmid#199355PurposeLentiviral transfer plasmid for doxycycline inducible expression of a N-terminally BFP-P2A-ALFA-SUMOstar-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsTagBFP-P2A-ALFA-SUMOstarExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS112 pHAGE2 CMVtetO2 MCS-TEV-22xGS-Alfa-P2A-TagBFP
Plasmid#199365PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally TEV-ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsTEV-ALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pet15b-Internalization and Endosomal Escape
Plasmid#186551PurposeInternalization and Endosomal Escape to effectively route a protein cargo to the cytosol of cellsDepositorInsert10R-8His-ETA-EGFP
Tags8xHis and EGFPExpressionBacterialPromoterT7Available SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET303-ColE1-T-E192C
Plasmid#180233PurposeExpresses T domain of Colicin E1 (residues 1-190) with C terminal cysteine for maleimide chemistryDepositorInsertColicin E1
Tags6x His-tagExpressionBacterialMutationTruncation of ColE1 containing T domains (residue…PromoterT7Available SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only