We narrowed to 2,608 results for: ERK
-
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28:LanIV-Chondromyces
Plasmid#225078PurposeExpresses precursor peptide and lanthipeptide synthetase from Chondromyces LanIV (FAST-RiPPs) in E. coliDepositorInsertLanA (LanIV-Chondromyces)
TagsHis6ExpressionBacterialMutationWTPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28:LanI-101
Plasmid#225065PurposeExpresses precursor peptide, lanthipeptide cyclase, and lanthipeptide dehydratase from LanI-101 (FAST-RiPPs) in E. coliDepositorInsertLanA (LanI-101)
TagsHis6ExpressionBacterialMutationWTPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS722A
Plasmid#216545PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: S722A) of human PTK2DepositorInsertPTK2 (S722A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation S722AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKY861F
Plasmid#216546PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: Y861F) of human PTK2DepositorInsertPTK2 (Y861F) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation Y861FAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS732A
Plasmid#216541PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: S732A) of human PTK2DepositorInsertPTK2 (S732A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation S732AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKS910A
Plasmid#216542PurposeThis retroviral plasmid expresses a mutated cDNA (dominant negative: S910A) of human PTK2DepositorInsertPTK2 (S910A) (PTK2 Human)
UseRetroviralTagsNoExpressionMammalianMutationFAK dominant negative mutation S910AAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
TLNRD1(4H)-2T_pET47b
Plasmid#224069PurposeBacterial expression of the 4-helix bundle of TLNRD1 (residues 143-273) containing the mutations L191T/A225T, fused to an N-terminal hexa-histidine tag. HRV-3C cleavage siteDepositorInserttlnrd1 (TLNRD1 Human)
Tags6xHISExpressionBacterialMutationL191T/A225T double mutant; reduces affinity of TL…PromoterT7Available SinceAug. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TLNRD1(4H)-2E_pET151
Plasmid#224068PurposeBacterial expression of the 4-helix bundle of TLNRD1 (residues 143-273) containing the mutations K192E/R233E, fused to an N-terminal hexa-histidine tag. TEV cleavage siteDepositorInserttlnrd1 (TLNRD1 Human)
Tags6xHIS; V5ExpressionBacterialMutationK192E/R233E double mutant; prevents actin binding…PromoterT7Available SinceAug. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CCM2_I432D_eGFP
Plasmid#208879PurposeExpress eGFP-CCM2 with the I432D mutation in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_W421AD422A_eGFP
Plasmid#208880PurposeExpress eGFP-CCM2 with the W421A and D422A mutations in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCM2_I428S_eGFP
Plasmid#208878PurposeExpress eGFP-CCM2 with the I428S mutation in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLeo-A-GEMS(JAK-STAT)
Plasmid#209109PurposeTransient mammalian expression of the CC functionalized GEMS receptor A-GEMS (JAK-STAT)DepositorInsertA-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLeo-A-a3-GEMS(JAK-STAT)
Plasmid#209111PurposeTransient mammalian expression of the CC functionalized GEMS receptor A-a3-GEMS (JAK-STAT)DepositorInsertA-a3-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLeo-B-a2-GEMS(JAK-STAT)
Plasmid#209112PurposeTransient mammalian expression of the CC functionalized GEMS receptor B-a2-GEMS (JAK-STAT)DepositorInsertB-a2-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLeo-G-a2-GEMS(JAK-STAT)
Plasmid#209113PurposeTransient mammalian expression of the CC functionalized GEMS receptor G-a2-GEMS (JAK-STAT)DepositorInsertG-a2-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-SUMO-A'-l2-A'-IRES-EmGFP
Plasmid#209125PurposeLentiviral vector including gene for CC-GEMS ligand SUMO-A'-l2-A' and EmGFPDepositorInsertSUMO-A'-l2-A'-IRES-EmGFP
UseLentiviralExpressionMammalianAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXD11wt-IDR
Plasmid#145242PurposeExpresses fusion of GAL4 DNA-binding domain and HOXD11wt-IDRDepositorInsertHOXD11wt-IDR (HOXD11 Human)
ExpressionMammalianAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-MNX1-Adel-IDR
Plasmid#145247PurposeExpresses fusion of GAL4 DNA-binding domain and MNX1-Adel IDRDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-TBX1-Adel-IDR
Plasmid#145253PurposeExpresses fusion of GAL4 DNA-binding domain and TBX1-Adel IDRDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TK4-EGFP
Plasmid#239047PurposePiggyBac plasmid for stable transgene expression during human pluripotent stem cell differentiationDepositorInsertsEGFP
puroR
ExpressionMammalianPromoterCAG and EF1aAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-CAG-NR5A1-FLAG
Plasmid#242229PurposeExpression of full-length human SF-1 using lentivirusDepositorAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
H3K9me3 biosensor
Plasmid#120802PurposeFRET biosensor. To monitor histone H3 lysine 9 tri-methylation in mammalian cells by FRETDepositorInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3
ExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF142_U6-sgRNA
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF153_Gag-Pol
Plasmid#225961PurposeCMV-Intron-GagPol (FMLV). Expresses FMLV (Friend Murine Leukemia Virus) Gag-Pol for VLP production.DepositorInsertCMV-Intron-GagPol (FMLV)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
24xMoonTag-kif18b-24xPP7 (MoonTag translation reporter)
Plasmid#128604PurposeExpresses 24xgp41 peptide array (MoonTag peptide array), followed by kif18b gene and 24 repeats of PP7 hairpins in 3’ UTR.DepositorAvailable SinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only