We narrowed to 18,548 results for: MUT
-
Plasmid#187151PurposeEntry cloneDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pAc5.1B-HA-DmDCP1-GSSGmut-dsRNAres_Q
Plasmid#147338PurposeInsect Expression of DmDCP1-GSSGmut-dsRNAresDepositorInsertDmDCP1-GSSGmut-dsRNAres (Dcp1 Fly)
ExpressionInsectAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Mcm2-2A mutation sgRNA
Plasmid#186936PurposesgRNA used for genetic mutation at Y81 and Y90 of Mcm2DepositorInsertMcm2-2A mutation sgRNA (Mcm2 Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cherry-Plekhh1 5 silent mutations
Plasmid#187373PurposeExpresses human Plekhh1 with 5 silent mutations labelled with CherryDepositorInsertPlekhh1 with 5 silent mutations
TagsmCherryExpressionMammalianMutationFive silent mutations at the Plekhh1 siRNA site (…PromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-PPK(mutant)
Plasmid#183942PurposeExpresses catalytic mutant of E. coli PPK from yeast GPD promoterDepositorInsertPPK(mutant) (ppk E. coli )
ExpressionYeastMutationmutations in His435, His454, and His592 to AlaninePromoterGPDAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p416-GPD-HA-PPK(mutant)
Plasmid#183944PurposeExpresses HA-tagged catalytic mutant of E. coli PPK from yeast GPD promoterDepositorInsertPPK(mutant) (ppk E. coli)
TagsHAExpressionYeastMutationmutations in His435, His454, and His592 to AlaninePromoterGPDAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA T7-Gnat1 Mut-3UTR
Plasmid#184027PurposeExpresses mouse Gnat1 protein with N-terminal T7 tag from cDNA that contains the mutant 3'-UTR where the TAG binding sites for MSI1 are mutated to TGADepositorInsertGnat1 (Gnat1 Mouse)
TagsT7ExpressionMammalianMutationTAG sites in the 3'-UTR are mutated to TGAPromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso2-6xmut_U
Plasmid#147732PurposeMammalian Expression of HsNot1iso2-6xmutDepositorInsertHsNot1iso2-6xmut (CNOT1 Human)
ExpressionMammalianMutation4 silent and two non silent G917E and R2353Q muta…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-10xmut_G
Plasmid#146428PurposeInsect Expression of DmGW182-10xmutDepositorInsertDmGW182-10xmut (gw Fly)
ExpressionInsectMutationMultiple mutations compared to NM_166780.1, see a…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD4-mT2A-mutated_rpsL-BSD-F
Plasmid#182338PurposeTemplate plasmid for PCR amplification of initial recombineering cassetteDepositorInsertBSD
UseMouse Targeting; Flp / frtExpressionBacterialAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsC2orf68-EBMmut_K
Plasmid#146761PurposeMammalian Expression of HsC2orf68-EBMmutDepositorInsertHsC2orf68-EBMmut (C2orf68 Human)
ExpressionMammalianAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-mut1_G
Plasmid#146415PurposeMammalian Expression of HsDCP1a-mut1DepositorInsertHsDCP1a-mut1 (DCP1A Human)
ExpressionMammalianAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE2mut_C
Plasmid#146021PurposeInsect Expression of nanos-3UTR-SRE2mtDepositorInsertnanos-3UTR-SRE2mt (nos Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-oskar-SRE1mut_C
Plasmid#146023PurposeInsect Expression of oskar-3UTR-SRE1mutDepositorInsertoskar-3UTR-SRE1mut (osk Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE1,2mut_C
Plasmid#146019PurposeInsect Expression of nanos3UTR-SRE1,2mutDepositorInsertnanos3UTR-SRE1,2mut (nos Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1C-Fluc-nanos-SRE1mut_C
Plasmid#146020PurposeInsect Expression of nanos-3UTR-SRE1mutDepositorInsertnanos-3UTR-SRE1mut (nos Fly)
ExpressionInsectAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmMe31B-mut1_E
Plasmid#146203PurposeInsect Expression of DmMe31B-mut1DepositorInsertDmMe31B-mut1 (me31B Fly)
ExpressionInsectAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
TetO::EGFP-hMeikin(8A mut)
Plasmid#174707PurposeDoxycycline inducible expression of human Meikin with 8 alanine mutations that eliminate Plk1 bindingDepositorInsertMeikin
TagsEGFPExpressionMammalianMutationS175A, T176A, T180A, S181A, S196A, T251A, T264A, …Available SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_CoordinatorMutant#2
Plasmid#173986PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with Coordinator motif #2 mutated
UseLuciferaseMutationCoordinator motif mutation #2PromoterSV40 promoterAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only