We narrowed to 9,835 results for: CAG
-
Plasmid#219650PurposeGeneration of nonsense mutation W241* in DesD, disrupting desferrioxamine biosynthesis by base editing CRISPRDepositorInsertgRNA targetting desD in Streptomyces
UseCRISPRAvailable sinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ75) AAV: U6-gRNA(cs1)-EF1a-Cre-P2A-mCherry
Plasmid#254581PurposeAAV backbone expressing Cre recombinase and mCherry from the EF1a promoter and one U6-driven sgRNA with SapI spacer and capture sequence in scaffoldDepositorInsertCre
UseAAVAvailable sinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
shMyb-1
Plasmid#247030PurposeUsed for a knockdown of MYB in human Megakaryocyte/Erythroid ProgenitorsDepositorAvailable sinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-TLS-CsALSgR1.1
Plasmid#245877PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS gene along with TLS mobile RNA sequenceDepositorInsertCsALSgR1.1
UseCRISPRExpressionPlantPromoterAtU3Available sinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYJ15-PB-U6-Nkx6.1-acti-gRNA1
Plasmid#131059PurposeActivation of NKX6.1 via SAM systemDepositorAvailable sinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ01-Guide-SOX17-E1-gRNA1
Plasmid#131046PurposeSOX17 Knock outDepositorAvailable sinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ04-Guide-SOX17-E2-gRNA1
Plasmid#131049PurposeSOX17 Knock outDepositorAvailable sinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ06-CRISPR-SOX17-E2-gRNA1
Plasmid#131051PurposeSOX17 Knock outDepositorAvailable sinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ08-CRISPR-SOX17-E1-gRNA1
Plasmid#131053PurposeSOX17 Knock outDepositorAvailable sinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO1846
Plasmid#235714PurposeExpression of mCherry-human Beclin 1 in mammalian cellsDepositorAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ITGB6
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SOX2_HDR
Plasmid#163752PurposegRNA expression vector to target the SOX2 stop codon for HDR gene tagging in human cells.DepositorAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-Tag-HA
Plasmid#218188PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cFOS-FRB-VP16-P2A-EGFP
Plasmid#210510Purposeexpresses cFOS-FRB-VP16 and EGFP component in rat hippocampal neuron cellsDepositorInsertFRB-VP16-P2A-EGFP
UseAAVExpressionMammalianPromotercFosAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 hygro sgUCK1
Plasmid#211524PurposeDeletes UCK1DepositorInsertsgUCK1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF1081
Plasmid#143757PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1080
Plasmid#142723PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#1/Cre
Plasmid#193225PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTsc1#1/Cre
Plasmid#193246PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only