We narrowed to 19,451 results for: cat
-
Plasmid#28067DepositorInsertZinc finger array targeting Encephalopsin (Opn3) (opn3 Zebrafish)
UseZebrafish targetingAvailable sinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pBV-Luc mut MBS3+4
Plasmid#16569DepositorInsertc-MYC binding sites (MYC Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationMutant MBS3+4Available sinceMarch 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
XE133 dnWnt-1 myc CS2+
Plasmid#16859DepositorInsertdnWnt-1 myc CS2+ (Wnt1 Mouse)
UseXenopus expressionTagsmycMutationWnt-1 gene is truncated after the SPNFC peptide s…Available sinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pET41a-MED19
Plasmid#15430DepositorAvailable sinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET41a-MED30
Plasmid#15431DepositorAvailable sinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf143
Plasmid#12831PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf143
ExpressionMammalianAvailable sinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf78
Plasmid#12766PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf78
ExpressionMammalianAvailable sinceDec. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf90
Plasmid#12778PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf90
ExpressionMammalianAvailable sinceDec. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN-ING2
Plasmid#13293DepositorAvailable sinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Hs PEG10-Dendra2 gag-pol
Plasmid#260088PurposeExpression of Human PEG10-dendra2 and CFP using IRESDepositorAvailable sinceAug. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
V12_ftnA-ftnA
Plasmid#253338PurposeV12 tagged ferritinDepositorAvailable sinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pT7II-2N3Rtau
Plasmid#249551PurposeRecombinant protein synthesis of 2N3R isoform of human TauDepositorInsertTau (2N3R) (MAPT Human)
ExpressionBacterialAvailable sinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorInsertNES-FRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterCAGAvailable sinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET19b-pps-gp32
Plasmid#236044Purposegp32, synthetic geneDepositorInsertgp32
TagsHis tagExpressionBacterialAvailable sinceJuly 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSEVAb887
Plasmid#217504PurposepSEVAb (SEVA 3.1), Type IIS compatible plasmid with sfGFP under the BBa_J23119 promoter, pSEVAb88 backbone, pUC oriDepositorInsertsuperfolder green fluorescent protein (sfGFP)
UseSynthetic BiologyMutationS30R, Y39N, F64L, S65T, Q80R, F99S, N105T, Y145F,…Available sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-FLAG3-drAgo2DY-EF
Plasmid#221716PurposeExpression of zebrafish Ago2 with D651E and Y680F mutations and N-terminal 3xFLAG tag in zebrafish embryos.DepositorInsertdrAgo2DY-EF (ago2 Zebrafish)
UseFish expressionTags3xFLAGMutationD651E and Y680F in active sitePromotersimian CMV IE94Available sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM-U6-reRNA-hsHEKsite_1_3
Plasmid#205638PurposereRNA guide targeting HEKsite_1_3DepositorAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only