We narrowed to 16,181 results for: nes
-
Plasmid#209470PurposeCloning protospacers for Cas12a editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas12a HH-DR-HDV
UseCRISPRPromoterHvU3Available sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC67895
Plasmid#209506PurposeCloning protospacers for Cas12a editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas12a-tRNA-DR-DR
UseCRISPRPromoterTaU6Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS84 (U6p::GGACAGTCCTGCCGAGGTGG)
Plasmid#193852PurposeEncodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGGDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
P-BT1763
Plasmid#188111PurposepBolux harboring the promoter region upstream of BT1763DepositorInsertThe B. thetaiotaomicron BT1763 promoter cloned into pBolux
ExpressionBacterialPromoterBT1763Available sinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pc-GAKIN-Ha
Plasmid#188246PurposeExpress GAKIN in mammalian cells with Ha tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGAKIN (KIF13B Human)
TagsHaExpressionMammalianAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP230-Lenti-TRE3G-4xMyc-GluN2B(E1479Q)-WPRE-pA
Plasmid#164795PurposepLenti vector backbone designed to express 4XMyc Tagged-GluN2B(E1479Q) from a TRE3G promoter.DepositorInsertGluN2B
UseLentiviralTags4xMycAvailable sinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHWBF06exp
Plasmid#130831PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertSUN2
TagsmCherry-FLAG-HAExpressionPlantPromoterCaMV 35SAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDS1902
Plasmid#167278PurposeExpression plasmid for Candida albicans containing a red-shifted firefly luciferaseDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertred shifted luciferase
PromoterACT1Available sinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAWp63-clone32 (Opti-SpCas9)
Plasmid#131736PurposeExpresses Opti-SpCas9 in mammalian cellsDepositorInsertOpti-SpCas9
UseLentiviralTagsFlagMutationR661A+K1003HPromoterEFSAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGB411
Plasmid#134760PurposepCambia CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRISPR/Cas9
UseCRISPRAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3H-U6EC1
Plasmid#134758PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-EC1Available sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SPIC_P2A_Hygro_Barcode
Plasmid#120484PurposeBarcoded lentiviral vector to express SPIC in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-HMGS
Plasmid#108945Purposeheterologous expression of HMGS of E. faecalis in E. coliDepositorInsertHMG-CoA synthase (HMGS)
TagsHis6-TagExpressionBacterialMutationA110GAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
LI LacZ
Plasmid#104528PurposeLI lacZ moduleDepositorInsertlacZ
UseCloning vectorAvailable sinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-MVK mazei
Plasmid#108947Purposeheterologous expression of MVK of M. mazei in E. coliDepositorInsertMevalonate kinase (MVK)
TagsHis6-TagExpressionBacterialAvailable sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBP-ORF
Plasmid#72949PurposeEntry vector for ORF's - PCR, gene synthesis or sub-clone using NdeI/BamHI. Alternatively use BsaI with CATA and TCGA fusion sites. Stop codon must be included upstream of chosen 3' restriction siteDepositorPublicationInsertLevel 0 - ORFs
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSYC-104
Plasmid#74792PurposepCS4+-NLS-EGFP-F2A-mCherry-CAAXDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNLS-EGFP-F2A-mCherry-CAAX
Available sinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pISH-Neurog1
Plasmid#74395PurposeUse to synthesize riboprobes for in situ hybridization (ISH) probe for Neurog1. Not for gene expression.DepositorInsertneurogenin 1 (Neurog1 Mouse)
Available sinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
Reb_82 aka PAS623
Plasmid#71228PurposeReb_1 with RebB(S82P, D88G)DepositorPublicationInsertReb locus
TagsnoneExpressionBacterialMutationRebB(S82P, D88G), RebA (G53A)Available sinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS SK mCherryROSAbsr
Plasmid#54321PurposeEncodes mCherry fused with out-of-frame blasticidin-S resistance gene with a linker containing a target for TALEN/CRISPR. Can use as a surrogate target to select cells expressing active TALEN/CRISPR.DepositorInsertmCherry and BlasticidinS-resistance
UseCRISPR, Mouse Targeting, and TALENExpressionMammalianPromoterCMVAvailable sinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only