We narrowed to 17,835 results for: por
-
Plasmid#137075PurposeGolden Gate Level 0 S module for N-terminal fluorescent protein taggingDepositorInsertmNeonGreen DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
FCK-QuasAr2-mRuby2 eFRET
Plasmid#59174PurposeFluorescent membrane voltage sensorDepositorInsertQuasAr2-mRuby2 eFRET
UseLentiviralExpressionMammalianAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSYC-97
Plasmid#31565DepositorInsertpCS4+-NLS-EGFP-P2A-mCherry-CAAX
Available SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMV-2mCh-PS
Plasmid#112268PurposeIDOCKS Acceptor ConstructDepositorInserttwo copies of mCherry followed by a pseudosubstrate peptide for PKC
TagsmChExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRT2B-GO2
Plasmid#136909PurposeLentivirus expressing GO2 sgRNADepositorInsertsgGO2
UseLentiviralMutationWTPromoterhU6Available SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCHERRY10
Plasmid#24664DepositorInsertmCherry
ExpressionBacterialAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pNM262
Plasmid#128412PurposeVanillic acid inducible production of lysostaphin. LsyT with the amyE signaling peptide for secretion.DepositorInsertLysostaphin (epr Staphylococcus simulans)
UseSynthetic BiologyTagsamyE SPExpressionBacterialPromoterPspank(V)Available SinceSept. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRATIO4212
Plasmid#141313PurposeGateway cloning compatible dual fluorescent ratiometric binary vectorDepositorTypeEmpty backboneTagsmScarlet-I and mVenusExpressionPlantPromoterUBQ10 promoterAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
BlatCas9
Plasmid#163792PurposeThe plasmid expresses human codon-optimized BlatCas9 and gRNA expression elements.DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only