We narrowed to 13,735 results for: 109
-
Plasmid#227976PurposeTo insert HA-tagged biotin ligase, BioID2, at the C-terminus of genes; yeast BioID, KanMX6 markerDepositorInsertBioID2
TagsHA tagExpressionYeastAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-BirA-HA3-KanMX6
Plasmid#227974PurposeTo insert HA-tagged biotin ligase, BirA, at the C-terminus of genes; yeast BioID with KanMX6 markerDepositorInsertBirA
TagsHA tagExpressionYeastAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pAM255
Plasmid#226899PurposemEOS3.2-GS-MBP-10xN-Pex15(1-309)-PSP-GSS-FLAG-6xHisDepositorInsertmEOS3.2
TagsmEOS3.2-GS-MBP-10xN-Pex15(1-309)-Prescission-GSS-…ExpressionBacterialPromoterT7Available SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pAM245
Plasmid#226889Purpose6xHis-PSP-GS-PANN(75-150)-(5aaGS)-Msp1(36-362)DepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only