We narrowed to 109 results for: 109
-
TypeBlog Post...human genome, the mouse genome is made up of 3 x 109 nucleotides (nt), and encodes 23,000 or so genes.... the gRNA will seek out its target among the 3 X 109 nt of genetic content in the mouse genome and the...
-
Using Ultrasound to Image Bacteria in vivo: Acoustic Reporter Genes
TypeBlog Post...The limit of detection for arg1 expressing ECN is 109 cells/ml, which is within the range of the ~1011... -
Sensing Neuronal Dopamine
TypeBlog Post...discovery." Expert opinion on drug discovery 6.2 (2011): 109-127. PubMed PMID: 21532928. PubMed Central PMCID:... -
No Llamas Required - Synthetic Nanobodies Against Membrane Proteins
TypeBlog Post... to other display systems using phage and yeast (109-1010 members). This selection step involves using... -
Simplify Cloning with in vivo Assembly
TypeBlog Post...multiple modifications will require ultracompetent (109 CFU/μg) cells. Primer design Using specific primer... -
CRISPR References and Information
TypeCollection...Bacteria: pCRISPR new spacer cloning pCRISPR PDF, 109 KB Mendenhall and Myers Mammalian: FLAG tagging endogenous...injection protocol pU6-BbsI-chiRNA ; phsp70-Cas9 PDF, 109 KB Orkin and Bauer Protocol for Genomic Deletions... -
Deep Mutational Scanning with One Pot Saturation Mutagenesis
TypeBlog Post... Biology In Vitro Mutagenesis Protocols, pg. 103-109. PubMed PMID: 20676978. 3. Wrenbeck, Emily E., Justin... -
Antibodies 101: Flow Cytometry
TypeBlog Post...fundamentals and recent instrumentation. Cytotechnology 64:109–130 . https://doi.org/10.1007/s10616-011-9415-0 Additional... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...canonical Wnt signaling. Proc Natl Acad Sci U S A, 2012. 109(27): p. E1848-57. PubMed PMID: 22645348. PubMed Central... -
Using AAV for Neuronal Tracing
TypeBlog Post...and 8 in the rat nigrostriatal system. J Neurochem 109, 838–845. PubMed PMID: 19250335. PubMed Central PMCID... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...combinatorial cell-subclass-specific labeling. Neuron , 109 (9), 1449–1449. https://doi.org/10.1016/j.neuron.2021.03.011...208157 pAAV-AiE0410m-minBglobin-SYFP2-WPRE3-BGHpA AiP12109 AiE0410m SYFP2 Oligodendrocytes Whole Brain 230388... -
Validated gRNA Sequences
TypeCollection...TTTCCAGGATTACGTAATAG 60967 cut S. pyogenes 24967838 Mashimo unc-109(n499) C. elegans GGAACTCGTGTCAAAACAAC 59932 cut S... -
Viral Vectors 101: Systemic Capsids
TypeBlog Post...combinatorial cell-subclass-specific labeling. Neuron,109(9), 1449–1464.e13. https://doi.org/10.1016/j.neuron... -
27 Hot Plasmids from 2016
TypeBlog Post...comparison, the DNA replication error rate is 1 per 109 bp. Unlike wt Cas9, CRISPR-X produces few indels,... -
Adeno-associated virus (AAV) Guide
TypeGuide...diseases . Cytokine & Growth Factor Reviews, 80 , 109–120. https://doi.org/10.1016/j.cytogfr.2024.09.003...Research, 25 (3), 489–499. https://doi.org/10.1007/s11095-007-9431-0 (Link opens in a new window) PMID: 17763830...Virology, 85 (Pt 8), 2209–2214. https://doi.org/10.1099/vir.0.79940-0 (Link opens in a new window) PMID... -
Hot Plasmids: Fall 2024
TypeBlog Post...Gen Virol., 73 (Pt 3), 653–660. https://doi.org/10.1099/0022-1317-73-3-653. PMID 1372038. Randall, R. E...Virol., 68 (Pt 11), 2769–2780. https://doi.org/10.1099/0022-1317-68-11-2769. PMID 2445904. New tool...elegans. Genetics, 228(2), iyae126. https://doi.org/10.1093/genetics/iyae126. Gene disruption in Mycobacterium... -
Plasmids 101: Stringent Regulation of Replication
TypeBlog Post...EMBO Journal, 17(17), 5201–5213. https://doi.org/10.1093/emboj/17.17.5201 del Solar, G., Giraldo, R., Ruiz-Echevarría...Acids Research, 46(12), 6140–6151. https://doi.org/10.1093/nar/gky457 Park, K., Han, E., Paulsson, J., & Chattoraj...EMBO Journal, 20(24), 7323–7332. https://doi.org/10.1093/emboj/20.24.7323 Resources at Addgene Read our... -
Viral Vectors 101: Pseudotyping
TypeBlog Post...Human Molecular Genetics 10:2109–2121 . https://doi.org/10.1093/hmg/10.19.2109 Sandrin V, Boson B, Salmon... -
Four Base Editing Reporters to Monitor and Enrich Editing in Real-time
TypeBlog Post... Acids Research 48:2841–2852 . https://doi.org/10.1093/nar/gkaa124 Martin AS, Salamango DJ, Serebrenik...Nucleic Acids Research 46:e84–e84 . https://doi.org/10.1093/nar/gky332 Standage-Beier K, Tekel SJ, Brookhouser... Acids Research 47:e120–e120 . https://doi.org/10.1093/nar/gkz713 Additional resources on the Addgene ... -
To Codon Optimize or Not: That is the Question
TypeBlog Post...Nucleic Acids Research 28:292–292 . https://doi.org/10.1093/nar/28.1.292 Sauna ZE, Kimchi-Sarfaty C (2011) ... Nucl Acids Res 15:1281–1295 . https://doi.org/10.1093/nar/15.3.1281 Slimko EM, Lester HA (2003) Codon... base pair. EMBO Rep 1:18–23 . https://doi.org/10.1093/embo-reports/kvd001 Additional resources on the...