Skip to main content

We narrowed to 23 results for: 109

Showing: 1 - 20 of 23 results
  1. CRISPR References and Information

    Type
    Collection
    ...Bacteria: pCRISPR new spacer cloning pCRISPR PDF, 109 KB Mendenhall and Myers Mammalian: FLAG tagging endogenous...injection protocol pU6-BbsI-chiRNA ; phsp70-Cas9 PDF, 109 KB Orkin and Bauer Protocol for Genomic Deletions...
  2. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...combinatorial cell-subclass-specific labeling. Neuron , 109 (9), 1449–1449. https://doi.org/10.1016/j.neuron.2021.03.011...208157 pAAV-AiE0410m-minBglobin-SYFP2-WPRE3-BGHpA AiP12109 AiE0410m SYFP2 Oligodendrocytes Whole Brain 230388...
  3. Validated gRNA Sequences

    Type
    Collection
    ...TTTCCAGGATTACGTAATAG 60967 cut S. pyogenes 24967838 Mashimo unc-109(n499) C. elegans GGAACTCGTGTCAAAACAAC 59932 cut S...
  4. The Pleiades Promoter Project

    Type
    Collection
    ... Ple108 HBEGF pEMS1253 EGFP/NLS Ple109 HBEGF pEMS1254 EGFP/NLS Ple109 HBEGF pEMS1580 intron-lacZ/NLS Ple110...NLS Ple167 POGZ pEMS1091 EGFP/cre/NLS Ple167 POGZ pEMS1427 EGFP/NLS Ple168 POGZ pEMS1092 EGFP/cre/NLS Ple168...Ple200 SLC6A5 pEMS1096 EGFP/cre/NLS Ple200 SLC6A5 pEMS1407 EGFP/NLS Ple201 SLC6A5 pEMS1097 EGFP/cre/NLS...NLS Ple173 RAMP3 pEMS1412 EGFP/NLS Ple174 RAMP3 pEMS1109 EGFP/cre/NLS Ple174 RAMP3 pEMS1413 EGFP/NLS Ple175...Ple177 RGS16 pEMS1649 intron-lacZ/NLS Ple178 RGS16 pEMS1090 EGFP/cre/NLS Ple178 RGS16 pEMS1366 EGFP/NLS Ple178... SLC6A5 pEMS1673 intron-lacZ/NLS Ple202 SLC6A5 pEMS1098 EGFP/cre/NLS Ple202 SLC6A5 pEMS1409 EGFP/NLS Ple203...NLS Ple230 THY1 pEMS1422 EGFP/NLS Ple231 TNNT1 pEMS1099 EGFP/cre/NLS Ple231 TNNT1 pEMS1435 EGFP/NLS Ple232...
  5. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AV-10-PV1090 105537-AAV1 pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase James M. Wilson AV-2-PV1090 105537-...Wilson AV-6-PV1090 105537-AAV6 pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase James M. Wilson AV-8-PV1090 105537-...CI.mCerulean.WPRE.RBG Control James M. Wilson AV-1-PV1090 105537-AAV1 pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase...pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase James M. Wilson AV-8-PV1091 107787-AAV8 AAV.TBG.PI.Cre.rBG Cre Recombinase ....WPRE.SV40 Cre Recombinase James M. Wilson AV-9-PV1090 105537-AAV9 pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase...pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-5-PV1090 105537-AAV5 pENN.AAV.CMVs.Pl.Cre.rBG James M. Wilson...pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-9-PV0109 105533-AAV9 pAAV.CMV.Luc.IRES.EGFP.SV40 James M...
  6. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin Nucleolus (granular component) 109120 GJA1-mEGFP...Gap junctions 109121 HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP ...Biol Cell. 28 (21), 2854–2874. https://doi.org/10.1091/mbc.E17-03-0209 (Link opens in a new window) PMID...
  7. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Parkinson's Kalle Gehring 227364 pGEX-parkin delta 101-109 PRKN GST, HRV 3C tac Parkinson's Kalle Gehring 227365...pET11a asyn Q109E (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105736 pET11a asyn Q79N (Q109H) (TAC-->TAT...pET11a asyn Q109N (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105738 pET11a asyn Q79N Q109N (TAC-->TAT...Gabriele Kaminski Schierle 109321 pU6-crRNA(SOD1) SOD1 hSyn1 ALS Feng Zhang 109322 pU6-crRNA(TBK1) TBK1 hSyn1...hSyn1 ALS Feng Zhang 109323 pU6-crRNA(TARDBP) TARDBP hSyn1 ALS Feng Zhang 109889 pHH0103_GIGYF2_GYF GIGYF2...Arrowsmith 210986 pHTN-HaloTag_C9orf72:1-481 C9orf72 Halo CMV ALS Cheryl Arrowsmith 210987 pHTC-HaloTag_C9orf72...Ron 22106 pWJPrP5 PRNP Dementia Susan Lindquist 22109 pWJPrP1 PRNP Dementia Susan Lindquist 22291 pcDNA3...
  8. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...177454 Anti-Calbindin [L109/39R] Calbindin Human Mouse IgG2a 177455 Anti-Calbindin [L109/57R] Calbindin Human...K+ channel Rat Mouse 182071 Calbindin scFv [L109/57] L109/57 Calbindin Human Mouse 182072 Parvalbumin ... [N212A/34R] TRIP8b (exon 1b) Mouse Mouse IgG2a 182109 Anti-GABA(A)R, Alpha6 [N229A/32R] GABA(A)R, Alpha6... Homer1 Mouse Mouse IgG2a 188187 Anti-Calbindin [L109/62R] Calbindin Human Mouse IgG2a 188188 Anti-Homer1...VIP Human Mouse IgG2b 206635 Anti-CALB1/calbindin [L109/39R-2b] CALB1/calbindin Human Mouse IgG2b 206636...VIP Human Mouse IgG1 206686 Anti-CALB1/calbindin [L109/39R-1] CALB1/calbindin Human Mouse IgG1 206687 Anti-Homer1L...Co-Rest/RCOR1 Human Mouse IgG2a 222146 Calbindin [L109/43R] Calbindin Human Mouse IgG2a 222147 Homer1 [...
  9. Immunology Research Plasmids and Resources

    Type
    Collection
    ...SBDS Shwachman-Bodian-Diamond syndrome CGI-97, FLJ10917, SDS, SWDS SEMA3A sema domain, immunoglobulin ...interleukin 21 IL-21, Za11 IL21R interleukin 21 receptor MGC10967, NILR IL22 interleukin 22 IL-21, IL-22, IL-D110...SBDS Shwachman-Bodian-Diamond syndrome CGI-97, FLJ10917, SDS, SWDS SCG2 secretogranin II (chromogranin... secreted phosphoprotein 1 BNSP, BSPI, ETA-1, MGC110940, OPN SST somatostatin SMST SSTR1 somatostatin ...oncogene homolog 2, avian) ERBA-BETA, ERBA2, GRTH, MGC126109, MGC126110, NR1A2, PRTH, THR1, THRB1, THRB2 TIE1...sarcoma viral oncogene homolog B1 B-RAF1, BRAF1, FLJ95109, MGC126806, MGC138284, RAFB1 CASP3 caspase 3, ...
  10. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ... its RNA binding. Editors carrying the delta-984–1090 ADAR2 truncation retain RNA editing capabilities...
  11. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...expressing double stranded break constructs. Plasmids 171098 and 175570 allow conversion to a dual guide construct...
  12. Optogenetics AAV Preps

    Type
    Collection
    ...soma-targeted) FusionRed Cre dependent 5 Ofer Yizhar 109048 pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST CAG eGtACR1...
  13. Luciferase Plasmid Collection

    Type
    Collection
    ...2.0). Diego Orzaez 68215 pEGB 35S:Renilla:Tnos (GB0109) Renilla 35S Transcriptional unit for Renilla luciferase...
  14. Caltech Systemic Capsids

    Type
    Collection
    ...new window) AAV9-X1.1: Chen et al., 2023 Pubmed 37291094 (Link opens in a new window) Don’t See What You...
  15. Bacterial Expression Systems

    Type
    Collection
    ...mRFP1) Gram-negative bacteria Philip Poole 14462 pRU1097 Promoter activity Fluorescence (GFPmut3.1) Gram-negative...
  16. Plasmids for Stem Cell Research

    Type
    Collection
    ...precursor cells. Proc Natl Acad Sci U S A. 2012 Feb 14;109(7):2527-32. Wernig Fibroblasts Neural Stem Cells...
  17. Plan Your Experiment

    Type
    Collection
    ..., 1536–1548. https://doi.org/10.1038/s41594-023-01090-9 PMID: 37783853 Zuris, J. A., Thompson, D. B., ...
Showing: 1 - 20 of 23 results