We narrowed to 8,541 results for: AMPH
-
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
plenti-FLAG-CAMK2D
Plasmid#221699PurposeLentiviral expression of FLAG-tagged human CAMK2D in mammalian cellsDepositorInsertCAMK2D (CAMK2D Human)
UseLentiviralAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNeg-Ma-barnase-TAG3-TAG45
Plasmid#197572PurposeNegative selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses 2xTAG-codon interrupted barnase gene and M. alvus Pyl-tRNA(6). p15a origin of replication.DepositorInsertsBarnase - 2xTAG
M. alvus Pyl-tRNA (6)
TagsnoneExpressionBacterialMutation3TAG and 45TAGPromoteraraC and lppAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
FUGW-Arl13b-N+RVEP+PR-EGFP-TurboID
Plasmid#248193PurposeLentiviral expression of truncated Arl13b containing the N-terminal amphipathic helix, cilium targeting RVEP, and the Proline-Rich domain at the C-terminus (cilium localization)DepositorInsertThe Arl13b cilium targeting sequence-EGFP-TurboID (Arl13b Mouse)
UseLentiviralTagsEGFP and TurboIDExpressionMammalianMutationTruncated to only contain N + RVEP + PR domainsPromoterhUBCAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304-GW-DCK*-IRES-GFP
Plasmid#176291PurposeGateway vector for use in generating POI-DCK* fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-GW-IRES-GFP
Plasmid#176289PurposeGateway vector for use in generating DCK*-POI fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
plenti-FLAG-CAMK2D-ED
Plasmid#221700PurposeLentiviral expression of FLAG-tagged human CAMK2D (K43R/D136N) in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCC1-4k-BBclone2
Plasmid#137070PurposeE. coli plasmid that contains the expression optimized genes for BB0323, P13, DipA and Lmp1DepositorInsertsBB0323
P13
DipA
Lmp1
ExpressionBacterialMutationwild-type, full-length (signal-peptide-containing…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-His6-3xFlag/nsp7/nsp8 (SARS-CoV-2)
Plasmid#169185PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag, nsp7 and nsp8 (SARS-CoV-2) in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7/nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlag (nsp12 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 2 Spacer
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBIG2abc_nsp12-His6-3xFlag/nsp7-Linker-nsp8 (SARS-CoV-2)
Plasmid#169184PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag and nsp7-Linker-nsp8 fusion in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7-Linker-nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlag (nsp12 C-terminus) and nsp7-nsp8 fusi…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-3xFlag/nsp7-His6-nsp8 (SARS-CoV-2)
Plasmid#169183PurposeBaculoviral transfer vector to co-express nsp12-3xFlag and nsp7-His6-nsp8 fusion in insect cellsDepositorInsertnsp12-3xFlag/nsp7-His6-nsp8 (ORF1ab SARS-CoV-2)
Tags3xFlag (nsp12 C-terminus) and His6 (as internal t…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169164PurposeBaculoviral transfer vector to co-express SARS-CoV-2 nsp14 and nsp10 in insect cellsDepositorInsertnsp14/nsp10-6His-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
Tags6His-3xFlag (nsp10 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only