We narrowed to 18,968 results for: gateway
-
Plasmid#111382PurposeARRET with approximately 130 telomere hexanucleotide repeats of TTAGGG and TTGGGG variant sequences under control of hH1 promoter and terminatorDepositorInserthH1-ARRET
UseGateway entry cloningPromoterhH1Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-P85(T576del)
Plasmid#40228DepositorInsertP85(T576del) (PIK3R1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationdeleted amino acid 576PromoterCMVAvailable SinceOct. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_UBE2V1_3UTR
Plasmid#65864PurposeCarries 3' UTR of UBE2V1, an RBPMS targetDepositorInsertUBE2V1 (UBE2V1 Human)
PromoterT7Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
psicheck_NDUFA6_3UTR
Plasmid#65886PurposeLuciferase assay vector, assessing regulation of NDUFA6 3' UTRDepositorInsertNDUFA6 (NDUFA6 Human)
ExpressionMammalianAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-blast-T7pol
Plasmid#255667PurposeConstitutively expresses T7 RNA polymerase under EF-1alpha promoter with blasticidin resistance marker.DepositorInsertT7 RNA polymerase
UseGateway Cloning and LentiviralExpressionMammalianAvailable SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-puro-T7pol
Plasmid#255666PurposeConstitutively expresses T7 RNA polymerase under EF-1alpha promoter with puromycin resistance marker.DepositorInsertT7 RNA polymerase
UseGateway Cloning and LentiviralExpressionMammalianAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-G418-T7pol
Plasmid#255671PurposeInducible expression of T7 RNA polymerase with G418 resistance marker.DepositorInsertT7 RNA polymerase
UseGateway Cloning and LentiviralExpressionMammalianAvailable SinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] G301A K302A-Myc
Plasmid#246383PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationTGGGATTGGTAAGACAACTAT to TGGGATTGCTGCGACAACTAT am…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc
Plasmid#246382PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationCCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCC…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
PSMA4_BirA_Cterm
Plasmid#221513PurposeFlag-tagged biotinylation enzyme for co-expression of Psma4DepositorAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-Prepro-3x-Adan
Plasmid#181733PurposeGalactose inducible expression of Prepro-3x-AdanDepositorInsertPrepro-3x-Adan
ExpressionYeastAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR3cDual-Wnk
Plasmid#203976PurposeEnrty clone for Gateway cloningDepositorInsertWnk (Wnk Fly)
UseUnspecifiedAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
deltaUBA-short-UBASH3A-V5-6xHis
Plasmid#195404PurposeMammalian expression of human short-form UBASH3A lacking the UBA domain with V5-6xHis tagDepositorInsertUBASH3A (UBASH3A Human)
TagsV5-6xHisExpressionMammalianMutationUBASH3A mutant lacking the UBA domainAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXP1-DEST-Noa1-HIS
Plasmid#191972PurposeDestination vector containing HIS-tagged NOA1 coding sequence.DepositorAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCellFree_KA1_SARS-COV-2_ORF9c
Plasmid#169397PurposeCell-free/mammalian expression vector for SARS-COV-2 virus ORF9c with N-term eGFPDepositorInsertSARS-COV-2 _ORF9c
UseCell-free expression vectorTagsHis and eGFPPromoterT7- CMV/CAGAvailable SinceJuly 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCellFree_KA1_SARS-COV-2_NSP14
Plasmid#169387PurposeCell-free/mammalian expression vector for SARS-COV-2 virus NSP14 with N-term eGFPDepositorInsertSARS-COV-2 _NSP14
UseCell-free expression vectorTagsHis and eGFPPromoterT7- CMV/CAGAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmCellFree_KA1_SARS-COV-2_NSP7
Plasmid#169381PurposeCell-free/mammalian expression vector for SARS-COV-2 virus NSP7 with N-term eGFPDepositorInsertSARS-COV-2 _NSP7
UseCell-free expression vectorTagsHis and eGFPPromoterT7- CMV/CAGAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only