We narrowed to 8,725 results for: chloramphenicol
-
Plasmid#89374PurposeVector for reporter assay of one mouse super-enhancer regionDepositorInsertIrf2bpl (Irf2bpl Mouse)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl I
Plasmid#89378PurposeVector for reporter assay of one mouse super-enhancer regionDepositorInsertIrf2bpl (Irf2bpl Mouse)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl H
Plasmid#89377PurposeVector for reporter assay of one mouse super-enhancer regionDepositorInsertIrf2bpl (Irf2bpl Mouse)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pAzF[TAG]
Plasmid#164579PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codonsDepositorInsertsMj pCNFRS[TAG] (aaRS1)
Mj pCNFRS[TAG] (aaRS2)
Mj tRNA[TAG]
ExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoteraraBAD, glnS, and proKAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG
Plasmid#91797PurposeLentiviral/gateway cloning vector for N-terminally tagging proteins of interest with the dTAG systemDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsFKBP F36VExpressionMammalianPromoterhPGKAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral-S-tdTomato
Plasmid#112579PurposeExpressing Shuttle-tdTomato, or NLS-NES-tagged tdTomato in a Lentiviral vectorDepositorInsertNLS-tdTomato-NES
UseLentiviralTagsnuclear export sequence and nuclear localization …ExpressionMammalianAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.2.t1
Plasmid#73546PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.2.t1
pAzFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg3 hp
Plasmid#218095PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX301
Plasmid#25895Purpose3rd generation lentiviral Gateway destination vector. Puromycin selection.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseGateway Cloning and LentiviralExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.1.t1
Plasmid#73547PurposetRNA synthetase/tRNA pair for the in vivo incorporation of p-azido-l-phenylalanine, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.1.t1
pAzFRS.1.t1
ExpressionBacterialAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX303
Plasmid#25897Purpose3rd generation lentiviral Gateway destination vector. Blasticidin selection.DepositorTypeEmpty backboneUseGateway Cloning and LentiviralExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.2.t1
Plasmid#73544PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.2.t1
pAcFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP
Plasmid#86457PurposeMouse stem cell retroviral vector including a puromycin resistance and BFP gene. sgRNA targets can be cloned in between the BbsI sitesDepositorInsertBFP
UseCRISPRExpressionMammalianPromoterPgkAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas-MmdCas12m-CBE1
Plasmid#192284PurposeMmdCas12m-CBE1 expressed under a constitutive promoterDepositorInsertMmdCas12m-CDA-UGI
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg2 hp
Plasmid#218094PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.1.t1
Plasmid#73545PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.1.t1
pAcFRS.1.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg1 hp
Plasmid#218093PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas-dCas12m
Plasmid#192275PurposeEncodes MmdCas12m (D485A) under a constitutive promoterDepositorInsertMmdCas12m
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only