We narrowed to 19,068 results for: cat
-
Plasmid#201027PurposeExpresses C-terminally FLAG tagged SARS-CoV-2 nsp7 in mammalian.DepositorInsertnon-structural protein 7 (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
Tags8xHis and FLAGExpressionMammalianPromoterT7 promoterAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR Human CASP9 -1
Plasmid#198419PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB80-hsKIF5B(1-560)Rigor-L-2xHA
Plasmid#193718PurposeExpression of HA tagged human kinesin-1 (KIF5B aa1-560) to anchor microtubulesDepositorInserthsKIF5B(1-560)Rigor-L-2xHA (KIF5B Human, Synthetic)
Tags2xHAExpressionMammalianMutationhsKIF5B(aa1-560), RIGOR: G234APromoterChicken beta-actinAvailable SinceMarch 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K49R-STAT3
Plasmid#123167PurposeExpresses K49R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK49R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K140R-STAT3
Plasmid#123169PurposeExpresses K140R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK140R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K685R-STAT3
Plasmid#123171PurposeExpresses K695R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK685R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp7-Nsp8-HF_GC3opt
Plasmid#157693Purposemammalian expression of C-terminally His8-Flag tagged Nsp7-Nsp8 fusion protein under control of a tetracycline-inducible promoterDepositorInsertNsp7-Nsp8-HF_GC3opt (ORF1ab SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046581
Plasmid#149064PurposeYeast Expression plasmid for SARS-CoV-2 RNA-dependent RNA polymeraseDepositorInsertSARS-CoV-2 RNA-dependent RNA polymerase (ORF1ab Budding Yeast, Severe acute respiratory syndrome coronavirus 2)
TagsCleavable thrombin;6xHISExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpGAL1Available SinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046249
Plasmid#148991PurposeYeast Expression plasmid for SARS-CoV-2 RNA-dependent RNA polymeraseDepositorInsertSARS-CoV-2 RNA-dependent RNA polymerase (ORF1ab Budding Yeast, Severe acute respiratory syndrome coronavirus 2)
TagsCleavable thrombin;3xFLAGExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpGAL1Available SinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
K560_AviN_coBirA
Plasmid#129766PurposeExpresses Drosophila Kinesin-1 truncated at 560 and biotinylated on the head for single-molecule assaysDepositorInsertKHC (Khc Fly)
TagsAvi-tag GLNDIFEAQKIEWH and His6ExpressionBacterialMutationTruncation at 559Available SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB63 - pL0_fLUC-I (CDS1)
Plasmid#123180PurposeGolden Gate (MoClo; CDS1) compatible luciferase gene from Photinuspyralis with an intron for transient and stable expression in plantsDepositorInsertLuciferase gene from Photinuspyralis with intron from U5 small nuclear ribonucleoprotein component (Arabidopsis thaliana)
UseLuciferase; Part for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgSf3b1(T1)
Plasmid#90424Purposeinduces dsDNA break within mouse Sf3b1 gene for subsequent homology-directed recombination and coding sequence mutagenesis at codon 700DepositorInsertmus Sf3b1 gRNA (Sf3b1 Mouse)
UseCRISPR; Guiderna encoding for gene editingExpressionMammalianPromoterU6Available SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTriEx4-ADCY6-C2 (917-1165 aa)
Plasmid#113904PurposeHis-S tagged cytoplasmic catalytic domain 2 of Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 cytoplasmic catalytic domain 2 (ADCY6 Human)
TagsHis-SExpressionBacterial, Insect, and Mamm…MutationPlease see Depositor CommentsPromoterT7, CMVAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 SIRT1-deltaExon2
Plasmid#105671PurposeMammalian expression construct of mouse SIRT1 short isoform (lacking Exon2)DepositorInsertSIRT1 (Sirt1 Mouse)
ExpressionMammalianMutationSynonymous base changes not affecting the protein…PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE(K294A) NLS-Flag
Plasmid#82469PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzyme, inactive formDepositorInsertmRNA capping enzyme (Rngtt Mouse)
TagsFlag and MycExpressionMammalianMutationchanged Lysine 294 to AlaninePromoterCMVAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE NLS-Flag
Plasmid#82468PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzymeDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRD2 gRNA (BRDN0001148966)
Plasmid#77985Purpose3rd generation lentiviral gRNA plasmid targeting human BRD2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only