We narrowed to 16,375 results for: grna
-
Plasmid#139461PurposeLentiviral vector with gRNA targeting GFP; includes puromycin selectable markerDepositorInsertGFP-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE unc13a GFP KI
Plasmid#131498PurposeEndogenous tagging of Munc13-1: C-terminal (amino acid position: A1762)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
BPK764
Plasmid#65767PurposeBacterial expression plasmid for SpCas9 & sgRNA (need to clone spacer into BsaI sites): T7-humanSpCas9-NLS-3xFLAG-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-BSD
Plasmid#216123PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the blasticidin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-GOLGA2
Plasmid#207791PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of GOLGA2 for knock-in.DepositorInsertsgRNA Targeting N-terminus of GOLGA2 (GOLGA2 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-KRAB-GFP backbone
Plasmid#194281PurposeVector for CRISPRi-GFP expression ready for gateway cloning of sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2517
Plasmid#91086PurposeModule C, Promoter: TaU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterTaU3Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgEGFP
Plasmid#86153PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)DepositorInsertEGFP
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg1
Plasmid#139450PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42337PurposeDual expression plasmid of human codon-optimized SpCas9 and a gRNA to the human Emx1 locus, can be used to test SpCas9 cleavage in cell lines of choice.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2515
Plasmid#91083PurposeModule C, Promoter: AtU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAtU6Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25H
Plasmid#91145PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ARL13B
Plasmid#227276PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of ARL13B for knock-in.DepositorInsertsgRNA Targeting C-terminus of ARL13B (ARL13B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only