We narrowed to 949 results for: GGCT;
-
Plasmid#76518Purpose3rd generation lentiviral gRNA plasmid targeting human DAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
LYN gRNA (BRDN0001148376)
Plasmid#77026Purpose3rd generation lentiviral gRNA plasmid targeting human LYNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000279887
Plasmid#78153PurposeshCDK4 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000279953
Plasmid#78154PurposeshCDK4 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
JAK3 gRNA (BRDN0001149232)
Plasmid#77189Purpose3rd generation lentiviral gRNA plasmid targeting human JAK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIO gRNA (BRDN0001487141)
Plasmid#78034Purpose3rd generation lentiviral gRNA plasmid targeting human TRIODepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HSPB8 gRNA (BRDN0001146985)
Plasmid#75641Purpose3rd generation lentiviral gRNA plasmid targeting human HSPB8DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K7 gRNA (BRDN0001149362)
Plasmid#77820Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K7DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA6-2
Plasmid#248529PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA6-2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA19-3
Plasmid#248547PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA19-3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgNT-2-EF1a-LibVec
Plasmid#239593Purposeexpresses non-targeting (NT) guide#2DepositorInsertNT (non-targeting guide)
UseAAV; To deliver a non-targeting guide (serving as…PromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ClipF-HA-2a-Hu VGAT sesRNA-2a-smV5-2a-tTA2-WPRE
Plasmid#239031PurposeExpression of ClipF, sesRNA in mammalian cells, with smV5 and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051d_sgCiPELO #1
Plasmid#229017PurposeExpression of CRISPRi PELO sgRNA #1DepositorAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETS1(12))-PGKpuro2ABFP-W
Plasmid#208550PurposeLentiviral vector expressing gRNA targeting human ETS1DepositorInsertETS1(12) (ETS1 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CDK6-E2(12))-PGKpuro2ABFP-W
Plasmid#200488PurposeLentiviral vector expressing gRNA targeting human CDK6-E2DepositorInsertCDK6-E2(12) (CDK6 Human)
UseLentiviralAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
Plasmid#209197PurposeMutagenesis of FaahDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_016-sgHRI
Plasmid#202443PurposeExpression of a guide RNA targeting HRIDepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only