We narrowed to 1,428 results for: aav vector plasmid
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2-Dreadd-hM3Dq-HA-P2A-tBFP
Plasmid#178707PurposeAAV vector for Cre-dependent transgene expression of Dreadd-hM3Dq-HA-P2A-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertDreadd-hM3Dq-HA-P2A-tBFP
UseAAVPromoterhSynAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR5 Mm ATP10B
Plasmid#216391Purposetransfer plasmid for AAV vector production of mCherry and miR for Mm ATP10BDepositorInsertmcherry and miR Mm ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B
Plasmid#216392Purposetransfer plasmid for AAV vector production of mCherry and miR for rat Rn ATP10BDepositorInsertmcherry and miR Rn ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR30 SCR
Plasmid#216393Purposetransfer plasmid for AAV vector production of mCherry and miR scramble (no target)DepositorInsertmcherry and miR control
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
scAAV-Cre
Plasmid#177933PurposeExpresses Cre-recombinase and can be packaged into AAV particles.DepositorInsertCAG-Cre
UseAAVExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV mGAD65(delE1) GFP WPRE SV40pA
Plasmid#177316PurposeTo produce the AAV vector that expresses GFP under the control of the mGAD65 promoter. The mGAD65 promoter has highly specificity to GABAergic interneurons.DepositorInsertmGAD65(delE1) promoter, GABAergic interneurons specific promoter
UseAAVAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CWB-yellow pre-eGRASP(p32)
Plasmid#111580PurposeAn AAV vector that expresses yellow pre-eGRASP(p32) under the CaMKIIa promoter.DepositorInsertyellow pre-eGRASP(p32)
UseAAVPromoterCaMKIIaAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEx-tdT-P2A-Mxra8
Plasmid#242478PurposeAAV vector expressing Mxra8 and tdTomato under cre-recombinase controlDepositorAvailable SinceSept. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-mGFP-MutCREB(S133A)
Plasmid#194642PurposeExpresses the fusion of monomeric-EGFP-tagged mutant CREB(S133A) in a Cre-dependent mannerDepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pM123: pAAV-EFS-CasRx-control presgRNA
Plasmid#166871PurposeAAV vector for expressing CasRx and control presgRNA for RNA-editingDepositorInsertsU6-control presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianPromoterEFS and U6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CWB-cyan pre-eGRASP(p32)
Plasmid#111579PurposeAn AAV vector that expresses cyan pre-eGRASP(p32) under the CaMKIIa promoter.DepositorInsertcyan pre-eGRASP(p32)
UseAAVPromoterCaMKIIaAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CWB-cyan pre-eGRASP(p30)
Plasmid#111586PurposeAn AAV vector that expresses cyan pre-eGRASP(p30) under the CaMKIIa promoter.DepositorInsertcyan pre-eGRASP(p30)
UseAAVPromoterCaMKIIaAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CWB-yellow pre-eGRASP(p30)
Plasmid#111587PurposeAn AAV vector that expresses yellow pre-eGRASP(p30) under the CaMKIIa promoter.DepositorInsertyellow pre-eGRASP(p30)
UseAAVPromoterCaMKIIaAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-yellow pre-eGRASP(p30)
Plasmid#111588PurposeAn AAV vector that expresses yellow pre-eGRASP(p30) under the tetO promoter.DepositorInsertyellow pre-eGRASP(p30)
UseAAVPromotertetOAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-yellow pre-eGRASP(p32)
Plasmid#111582PurposeAn AAV vector that expresses yellow pre-eGRASP(p32) under the tetO promoter.DepositorInsertyellow pre-eGRASP(p32)
UseAAVPromotertetOAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only