We narrowed to 1,459 results for: aav vector plasmid
-
Plasmid#135619PurposeDonor vector for genomic targeting of a CAG-FLEX-mStrawberry cassette to the mouse Rosa26 locusDepositorInsertCAG-FLEX-mStrawberry flanked by Rosa26 homology arms (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO- alpha-MSH
Plasmid#239044PurposeOverexpression of alpha-MSHDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-beta-Endorphin
Plasmid#239043PurposeOverexpression of beta endorphinDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(AAVS1)-PGKpuro2ABFP-W
Plasmid#200459PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ08-pAAVsc.U6-tracrRNA
Plasmid#211816PurposeAAV vector expressing tracrRNA under U6 promoterDepositorInsertU6-tracrRNA
UseAAVExpressionMammalianPromoterU6Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-F14F15S-jGCaMP7s
Plasmid#178514PurposeAAV vector for Flpo recombinase dependent jGCaMP7sDepositorInsertjGCaMP7s
UseAAVExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-mem-seTurboID
Plasmid#237887PurposeAAV vector for Cre-dependent expression of membrane-tethered seTurboIDDepositorInsertmem-seTurboID
UseAAV and Cre/LoxTagsFLAG tag and GAP43 palmitoylation signalExpressionMammalianPromoterCAGAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-HBA-RIBEYE-eGFP
Plasmid#241988PurposeHuman RIBEYE cDNA cloned inframe into a pAAV-GFP vector driven by hybrid CMV-enhancer-human-beta-actin promoter (CMV-HBA) and containing downstream WPRE, Ampicillin ResistanceDepositorArticleInsertRIBEYE-GFP (CTBP2 Human)
UseAAVTagseGFPExpressionMammalianPromoterhybrid CMV-enhancer-human-beta-actin promoter (CM…Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-1P-WPRE
Plasmid#202611PurposeDouble floxed genetically encoded voltage indicator (GEVI) JEDI-1P in AAV production vector expressed under the mammalian promoter (EF1a)DepositorInsertJEDI-1P
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-GAL4-iLight-VP16
Plasmid#170274PurposeNLS-Gal4(1-65)-iLight(human codon optimized)-VP16 construct expression in mammalian cells. pAAV vector.DepositorInsertNLS-Gal4(1-65)-iLight(human codon optimized)-VP16
UseAAVMutationSee CommentsPromoterCaMKIIAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1617 pAAV SYN1 Nuc-EYFP
Plasmid#135567PurposeAn AAV vector expressing a neuronally expressed nuclear EYFP reporterDepositorInsertsempty
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterhSYN1Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2234 - pAAV Nestin GFP-iCre
Plasmid#228443PurposeAn adeno-associated viral vector to express GFP-iCre fusion protein under the human Nestin 2nd intron enhancer.DepositorInsertGFP-iCre
UseAAVExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2-Dreadd-hM3Dq-HA-P2A-tBFP
Plasmid#178707PurposeAAV vector for Cre-dependent transgene expression of Dreadd-hM3Dq-HA-P2A-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertDreadd-hM3Dq-HA-P2A-tBFP
UseAAVPromoterhSynAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR30 SCR
Plasmid#216393Purposetransfer plasmid for AAV vector production of mCherry and miR scramble (no target)DepositorInsertmcherry and miR control
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-PGC-1alpha-IRES-mCitrine
Plasmid#241791PurposeExpression vector for mouse Pgc-1alpha with mCitrineDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR5 Mm ATP10B
Plasmid#216391Purposetransfer plasmid for AAV vector production of mCherry and miR for Mm ATP10BDepositorInsertmcherry and miR Mm ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B
Plasmid#216392Purposetransfer plasmid for AAV vector production of mCherry and miR for rat Rn ATP10BDepositorInsertmcherry and miR Rn ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY59_TRAC-LHA-pAAV-EFS-CD22BBz-PRODH2(stop)-TRAC-RHA(3166mut)
Plasmid#192189PurposeCD22 CAR AAV vector PRODH2(StopCtrl) (pLY059)DepositorInsertCD22 CAR AAV vector PRODH2(StopCtrl) (pLY059) (CD22 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only